SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01595
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.952 PlasmaMembrane   Reliability : 1.288
 

Sequence

CDS
ATGCAATGTCCCAGCTGCATAAGATATGGAGAGACCAGAAAAACTAAAACCAAATTGGTGAGTTCGCTAGTTTTCTCCATATTCAATTATGGCGCGGAGACCTGGACAATGAAGAAGGCCGACAGAGACCGAATAGACGCTTTTGAAATGTGGTGTTGGAGAAAAATGCTACAGATTCCATGGACCGCCTTTCGCACCAACGTGTCTATTCTGAGAGAGCTTCATATCAAAGCCAGACTTTCCACTATATGCCTTCGTGGGGTGCTGGAATTCTTCGGACATATTGCTTGTAAAGAGGGTCACAATCTTGAACAGCTGATGGTGACAGGAAAGGTATATGGCAAACGTCCCAGAGAACGCAGTCCCACGAGATGGTCGGACCAAATACGATCTTCTCTGAGCATCAATTTCCATAATGCCCTTTATGAAGCAAAGGATCGCGGCAGATGGAGGGAAGTCGTATGGGAGAAACTGATGCAGCGGGGGAGTCTCGACCCTCAGTAA
Protein
MQCPSCIRYGETRKTKTKLVSSLVFSIFNYGAETWTMKKADRDRIDAFEMWCWRKMLQIPWTAFRTNVSILRELHIKARLSTICLRGVLEFFGHIACKEGHNLEQLMVTGKVYGKRPRERSPTRWSDQIRSSLSINFHNALYEAKDRGRWREVVWEKLMQRGSLDPQ

Summary

EMBL
FJ265548    ADI61816.1    ODYU01003523    SOQ42419.1    ODYU01001007    SOQ36619.1    + More
ODYU01004401    SOQ44236.1    FJ265557    ADI61825.1    FJ265546    ADI61814.1    FJ265553    ADI61821.1    FJ265547    ADI61815.1    GU815090    ADF18553.1    FJ265560    ADI61828.1    FJ265552    ADI61820.1    KZ150203    PZC72267.1    FJ265559    ADI61827.1    MRZV01000056    PIK60437.1    MRZV01002322    PIK33998.1    MRZV01000817    PIK43880.1    MRZV01000940    PIK42365.1    MRZV01000378    PIK51329.1    MRZV01001216    PIK39650.1    MRZV01000196    PIK55924.1    AHAT01022938    MRZV01000994    PIK41715.1    MRZV01001207    PIK39730.1    AJ132772    CAA10770.1    AHAT01009145    BART01031562    GAH15691.1    AAGJ04161766    AHAT01015286    BDSA01000081    GBE63537.1    KL363256    KL367985    KFD50217.1    KFD59415.1    AAGJ04055194    NWSH01002736    PCG67606.1    LK055282    CDR71995.1    AHAT01013157    AHAT01013158    AHAT01012943    ABLF02042206    ABLF02024992    ABLF02024994    ABLF02025002    ABLF02043975    HACG01049248    HACG01049253    CEK96113.1    CEK96118.1    HACG01049251    HACG01049252    CEK96116.1    CEK96117.1    HACG01049244    HACG01049247    CEK96109.1    CEK96112.1    AHAT01022314    KK852482    KDR22935.1    KK853249    KDR09341.1    KK852941    KDR13536.1    KK852843    KDR15156.1    HACG01049255    CEK96120.1    AHAT01025955    HACG01049245    CEK96110.1    HACG01049249    CEK96114.1    KK852811    KDR15914.1    AHAT01017643    KK853131    KDR10935.1    GDHC01017214    JAQ01415.1    KZ149985    PZC75696.1    AAGJ04167631    AAGJ04021158    KK852530    KDR21932.1    KK852456    KDR23625.1    GU815089    ADF18552.1    HACG01049494    HACG01049495    CEK96359.1    CEK96360.1    GGMR01005851    MBY18470.1    ABLF02031909    LBMM01001656    KMQ95932.1    AAGJ04075245    KF881086    AIJ27485.1    GBRD01005612    JAG60209.1    AFYH01119920   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03221   HTH_Tnp_Tc5
PF04218   CENP-B_N
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR002138   Pept_C14_p10       
IPR006600   HTH_CenpB_DNA-bd_dom       
IPR007889   HTH_Psq       
IPR009057   Homeobox-like_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF46689   SSF46689       
Gene 3D

Ontologies

Topology

Length:
167
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.68711
Exp number, first 60 AAs:
3.66687
Total prob of N-in:
0.35985
outside
1  -  167
 
 

Population Genetic Test Statistics

Pi
160.028609
Theta
129.471277
Tajima's D
0.741312
CLR
0
CSRT
0.583470826458677
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号