SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01592  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA008829
Annotation
PREDICTED:_alaserpin-like_[Bombyx_mori]
Full name
Alaserpin      
Alternative Name
Serpin-1
Location in the cell
Mitochondrial   Reliability : 2.401
 

Sequence

CDS
ATGTACAGTGATACGAGCAACAGGTTAAGTCCAGCTTTCATAGATACCTACAACAAAACCTTTGGTGGTAAGGCTAGGACTGTGGACTACAGTGACACCGTTAAAGCTGCCAATGAGATCAATGATGAGGTTGAAAATGAAGGAGAGTTCAATAATATAATCTCCAGTAAAATGATAAAGGAAGGAGGCGGTCTTAGTTTTATAAGCAGCTACGTGTTGACTATCATGTACAGCGACAAATTCAAATTCATAAACGAGAAAACAATAAACTTCAAATCTGGTAACAAGGTGATAAATATTCCAGGAATTACCGGGGAAGGTGTAGTGAAATATGCCGACATAAAGTCTATTGATGCCAAGACCATAGAATTGGAAGGTAAAGATGGACTATACTCGTATATCATGGTCCTTCCAAACAAACATGATGGACTTCTGGAAGTACTAGAAAAGCTCTGTGATTCTACAGCTTTCCAAGAAATTCTTGATCGTGGCGAGGAAGTATGCGCAAAATTATCCATCCCAGCCGGAGACTTGATTGCCAAATGTGACTTAGAAAAGACAGCTAAAGAATCAAATTTATTAAGAGATATATTCGAAGAGGGGAGACTCGAACTCCAAGGTGTGAGTCATAAATATAATAATACATACGTTTCGTCAATCCTACATGAAGTTCATTTGAAGCCAGGTCCGATCATTTACGATGAGCCCAGAGAATTATGTTCTATGCCTCAAATAGAACTGGAGATGAACCGTCCTCATTTGTTCTACGTGACTTTCACACAGAAGGTTGGCCCGATCCGTACCCCAATAGTCGGTGTAGTGTTTGACATCACGGGTACAACAAGCAACTAG
Protein
MYSDTSNRLSPAFIDTYNKTFGGKARTVDYSDTVKAANEINDEVENEGEFNNIISSKMIKEGGGLSFISSYVLTIMYSDKFKFINEKTINFKSGNKVINIPGITGEGVVKYADIKSIDAKTIELEGKDGLYSYIMVLPNKHDGLLEVLEKLCDSTAFQEILDRGEEVCAKLSIPAGDLIAKCDLEKTAKESNLLRDIFEEGRLELQGVSHKYNNTYVSSILHEVHLKPGPIIYDEPRELCSMPQIELEMNRPHLFYVTFTQKVGPIRTPIVGVVFDITGTTSN

Summary

Similarity
Belongs to the serpin family.
Keywords
3D-structure   Alternative splicing   Glycoprotein   Protease inhibitor   Secreted   Serine protease inhibitor   Signal  
Feature
chain  Alaserpin
EMBL
EU935625    ACG61187.1    BABH01037567    BABH01037568    BABH01037569    BABH01037570    + More
EU935616    ACG61178.1    BABH01037571    BABH01037572    EU935618    ACG61180.1    EU935621    ACG61183.1    BABH01037565    EU935626    ACG61188.1    EU935624    ACG61186.1    BABH01039199    EU935631    ACG61193.1    EU935620    ACG61182.1    U58361    AAC47341.1    AAC47332.1    MG770321    AXY94923.1    AAC47336.1    JN033737    AEW46890.2    MG770320    AXY94922.1    L20790    AAA29328.1    AAC47335.1    L20793    AAA29334.1    M23438    L20792    AAC47339.1    AAC47334.1    AAC47338.1    AAC47340.1    AAC47333.1    AAC47342.1    AAC47337.1    MG753798    AYC12555.1    MG753799    AYC12556.1    GEBQ01030062    JAT09915.1    GEBQ01031830    JAT08147.1    JN033738    AEW46891.2    GEBQ01012324    JAT27653.1    AGBW02014593    OWR41373.1    GEBQ01001894    JAT38083.1    KF873763    AHI48498.1    GEBQ01022377    JAT17600.1    GEBQ01021952    JAT18025.1    GECU01017579    JAS90127.1    GAMC01005784    JAC00772.1    KM280385    AIW39913.1    KZ150134    PZC73004.1    HQ615869    ADT63775.1    BABH01039200    GECU01016985    JAS90721.1    KC577446    AHC06147.1    GECU01034479    JAS73227.1    GECU01013546    JAS94160.1    EU368832    ABY68556.1    GDRN01080305    JAI62250.1    GDRN01080302    JAI62252.1    GECU01025480    JAS82226.1    KR140160    ALF44673.1    GDRN01080301    JAI62253.1    GDRN01080303    JAI62251.1    GDRN01080307    JAI62248.1    GBXI01007869    JAD06423.1    GBXI01011724    JAD02568.1    EU040210    ABW17158.1    GBXI01004114    JAD10178.1    PYGN01000723    PSN41681.1    EU040209    ABW17157.1    CM000157    KRJ98200.1    KRJ98201.1    KRJ98195.1    KRJ98194.1    GDRN01080306    JAI62249.1    KRJ98192.1    KRJ98193.1    EU040208    ABW17156.1    GECZ01018515    GECZ01006882    JAS51254.1    JAS62887.1    KJ489357    AHZ96593.1    ABY68559.1    ABY68561.1    ABY68557.1    ABY68560.1    ABY68558.1    ABY68555.1    JTDY01000556    KOB76688.1   
Pfam
PF00079   Serpin        + More
PF01826   TIL
Interpro
IPR042178   Serpin_sf_1        + More
IPR023796   Serpin_dom       
IPR000215   Serpin_fam       
IPR036186   Serpin_sf       
IPR042185   Serpin_sf_2       
IPR023795   Serpin_CS       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
SUPFAM
SSF56574   SSF56574        + More
SSF57567   SSF57567       
Gene 3D
PDB
1SEK     E-value=9.63254e-14,     Score=185

Ontologies

Topology

Subcellular location
  
Length:
283
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.59638
Exp number, first 60 AAs:
0.01773
Total prob of N-in:
0.08954
outside
1  -  283
 
 

Population Genetic Test Statistics

Pi
254.530769
Theta
180.283287
Tajima's D
2.929023
CLR
0.318927
CSRT
0.975901204939753
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
27102218 ESNIIRDIFEEGRIEIQGVSHK 100.00 5e-14
25860555 CVIPEDCSK 100.00 1e-07
27102218 SGNKVINIPGITGEGVVK 100.00 1e-07
27102218 ISIPAGDIIAKCDIEK 100.00 4e-05
25860555 ENDYFVYK 100.00 6e-04
24093152 TPIPGGPR 100.00 6e-04
27102218 VINIPGITGEGVVK 100.00 6e-04
25860555 AVVQDGSNVYVNR 100.00 0.018
24093152 VINGVPEK 100.00 0.018
27102218 ICDSTAFQEIIDRGEEVCAK 100.00 0.018
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号