SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01591
Pre Gene Modal
BGIBMGA008831
Annotation
serine_protease_inhibitor_15_precursor_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.3
 

Sequence

CDS
ATGTTTCGGATCCTGACGCTCTGTTGTGTCCTGACGTTAATGTTGGTTGAAGCTAATAGAGACTTATTAGAAGCTAAAAAACGTTTAGATGCTGCCAACAGTCGAATAATCGGAGAATTTCTATATCAAGGTGCCAAAAGAAACCCTGGTGAAATCTATACGTCTGCACTATTACCTATTTTGGCAGCCGCAGGACAGCTTGCGTTGTTCTGCAGAGAGAAAACGTGTGATCAGCTATTGAACTTCCTAAATTTAAAATATAAAGCAGAGATTCTCGTGCTTTTTCCTATACTAAGGAAGACATTATTCGATGAAAGTCTAATCGGTTCGCCGTCACTGAATTTAAATGTCTACGCTGATGAGGACAACAAGTTCTGTAAGGCGTTCACTCAATCCTACTACAAGACCTTCGAGGGTAAGACCAGGCTTGTGGACTACAGTGACCCGGTGGGAGCGGCTAAGGAGATTAATAATGAGGTAAAAGAGGAAGGCTCAGGAAACTTCAAGAGCTTAATTTCTAGTAAGATGATAAAGGAAGGAGCCGGTCTCAATTTTGTAAGCACCTACGAGCAGACTGTTATATACGACGATCAATTTATATTCAAGAAAAACGTAACGATAAAATTCAAATCCGGCCGCAAGGTGACCAACGTCCCGGGCATCGCCGGGGAAGGTATCGTGAAATATGCCGACCTAAAAGATTTTGACGCCAAGAGCTATGAACTGGTCGGCGAAGGTGAAGTAAACTCGTATCTCATAGTTGTTCCGAACAAACCTGATGGACTTCTCGGATTATTGGATAAATTACGTAGTCCTACAGCTTTTGGAGATATTCTTGAACGCGGAGAAGAAGTTTGTGCGAAAATATCGATCTTATACAGGGACTTTATTGCTAAGATCGATTTAGGGAAGTCTGCCCGAGAGTCAAATTACTTGGAGGGTGCTTTCCAAGAGGGAGGTCTTCAGCTCCGAGGTGTAAGTCAAAAGTGCAACAAAACGTACATCTCGTCAGTTCTACACGAAGTTTCCTTGAAATTAGGATTTGGTAATGGATACAAAGATGCGATGCGGATCGGCTGGTGTCCCGTCAGCGAGATACGGCAAACTGACGCCTCGATATGTAAGAGCGAGGGAGTATCGAGAGAGACACAGTGCAGGGCCCGCCTATAGTGCACACTAACCGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAGATGTTGACCGGCCATGGGTGTTTTGGCCGGTACCTCTTCAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGATCGCGACGAAGAAGACACAGCGGAACATACATTGGCGCGTTGCTCTGGTTTCGATGAGCAACGCGCCGCCCTCGTCGCGGTCATAGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCACTTATTAGAAGCTAAGAAACGTTTAGATGCTGCCAACAATCGAATAACTGGAGAATTTCTATATCAAGGAGCAAAAAGAAACCCTGGTGAAATCTATACGTCTGCACTATATCCTATTTTGGTAGCCGCGGGACAGCTCGCATTATTCTGCAAGGAGACAACGTGTGATCATCTACTTAAGTTCCTAAATTTGAAAGACAAAGCAGAGATTCTCGCGCTTTTTCCTACAATAAGGAGGATATTTTTCGACGAACCCCTAATCGGTTTGCCGTCACTGAATTTAAATGTCTACGCTGATAAGGACAACAAGTTCTGTAAGGCGTTCACTCAATCCTACTACAAGACCTTCGGGGGTAAGACCAGGCTTGTGGACTACAGTGACCCGGTGGGAGCGGCTAAAGAGATTAATAATGAGGTAAAAGAGGAAGGCTCAGGAAGATTCAAGAGTTTAATTTCTAGTAAGATGATAAAGGAAGGAGCCGGTCTCAATTTCGTAAGCACCTACGAGCAGACTATCATATACGACGATCAATTTATATTCAAGAAAAACGTAACGATAAAATTCAAATCCGGCCGCAAGGTGACCAACGTCCCGGGAATCGCCGGGGAAGGTATCGTGAAATATGCCGACCTAAAAGATTTTGACGCCAAGAGCTATGAACTGGTTGGCGAACGTGGATTATGTTCATATCTCATACTTGTTCCGAACAAACCAGATGGACTTCTTGGATTATTGGACAAATTACGTAGTCCTACAGCTTTTGGAGAAATTCTTGAACGCGGAGAAGAAGTTTGTGCAAAAATATCGATCTTATACAGAGACTTAATCGCTAAGGTTGATTTAGGAAAATCTGCCCGAGAGTCAAATTACTTGGAGGGTGCTTTCCAAGAGGGAGGTCTCCAGCTTCGGGGTGTAAGTCAAAATTGCAACAATACATACATCTCCTCGGTTCTACACGAGGTTTCCTTGAAATCAAGGTTTAGTAATGGATACAAAGCTAGTAAATGTTCCAAATTCGACGTGGAGCTCGTTACCAACCGTCCTCACTTGTACTTCGTGACGTATACTAAGAAGGTTAGCCCGATCCGCACGCCCGTAGTAGGGGTGGTCGTCGACCTAACTACCAACTAA
Protein
MFRILTLCCVLTLMLVEANRDLLEAKKRLDAANSRIIGEFLYQGAKRNPGEIYTSALLPILAAAGQLALFCREKTCDQLLNFLNLKYKAEILVLFPILRKTLFDESLIGSPSLNLNVYADEDNKFCKAFTQSYYKTFEGKTRLVDYSDPVGAAKEINNEVKEEGSGNFKSLISSKMIKEGAGLNFVSTYEQTVIYDDQFIFKKNVTIKFKSGRKVTNVPGIAGEGIVKYADLKDFDAKSYELVGEGEVNSYLIVVPNKPDGLLGLLDKLRSPTAFGDILERGEEVCAKISILYRDFIAKIDLGKSARESNYLEGAFQEGGLQLRGVSQKCNKTYISSVLHEVSLKLGFGNGYKDAMRIGWCPVSEIRQTDASICKSEGVSRETQCRARLXCTLTDWVGRDRGCLTFRLTQMLTGHGCFGRYLFKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYAHLLEAKKRLDAANNRITGEFLYQGAKRNPGEIYTSALYPILVAAGQLALFCKETTCDHLLKFLNLKDKAEILALFPTIRRIFFDEPLIGLPSLNLNVYADKDNKFCKAFTQSYYKTFGGKTRLVDYSDPVGAAKEINNEVKEEGSGRFKSLISSKMIKEGAGLNFVSTYEQTIIYDDQFIFKKNVTIKFKSGRKVTNVPGIAGEGIVKYADLKDFDAKSYELVGERGLCSYLILVPNKPDGLLGLLDKLRSPTAFGEILERGEEVCAKISILYRDLIAKVDLGKSARESNYLEGAFQEGGLQLRGVSQNCNNTYISSVLHEVSLKSRFSNGYKASKCSKFDVELVTNRPHLYFVTYTKKVSPIRTPVVGVVVDLTTN

Summary

Uniprot
ProteinModelPortal
PDB
1K9O     E-value=3.55153e-12,     Score=177

Ontologies

GO

Topology

SignalP
Position:   1 - 18,         Likelihood:  0.989301
 
 
Length:
907
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.613619999999999
Exp number, first 60 AAs:
0.31024
Total prob of N-in:
0.02847
outside
1  -  907
 
 

Population Genetic Test Statistics

Pi
283.392106
Theta
176.589784
Tajima's D
2.14313
CLR
0.172614
CSRT
0.904304784760762
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号