SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01588
Annotation
hypothetical_protein_OBRU01_06171_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 1.879 PlasmaMembrane   Reliability : 1.614
 

Sequence

CDS
ATGGAGTCGTTAGTAGTAGATAAAATTACTGAACGTTTACCGACTACCACAGTTGATGCCTCTCTTTTATCGAATTTCGAAGACATAGAATTGGCAGACGATACTTACTTTAACCCAGGCCCGATCCAACTGTTGATTGGAGCTTCGATTTTCCCGCATCTGCTCTTATCGAAAAAGGTTCAAGGACGGCCTTCGCATGCCTCGCCGATCGCGTTAGAGACTATCCTCGGTTATGTTATTGTTGGTGACGCTCCCGTTCGTGTAGCTAGCAACGAGAGCCTTTCATATTGCTGTACCGGAGACCCGTTAGACTCCACAATTCGGAAGTTTTGGGAATTAGAGGAGGTAGACGTGCCGTCTGTACTCAGCCCCGAGGACAAAATGTCTGAGGAGTTTTATACCAGTACTACCACACGAGATAGTGACGGACGATACGTGGTGGCTTTGCCCTTTAAAGGTGATGTTAACACTCTCGGTAATTCGCGTCAAGCAAGTGAAAGTCGATTTTACTGCTTAGAAAGAAAGATGCAAGCTTCTCCGCAGCTAAAATTAGCGTACGACAACATCATTCTCGAATATTTAGAGAAGAACTATCTCTCAGCTGTAGATTGTGACAGTTCAGATATTTCTTATTTTATTCCGCATCATGGTGTAATCAAAGAAGATAAGGTCACAACCAAATTAAGAGTCGTACTCGATGGTAGTTGTAAGACTACTACTAATGTTTCGCTCAATGATCTGTTATATCGTGGACAAAATTTCCAAGGAAATTTATTTAATATTATTATTAATTTTCGTTTGTTTCCGGTTGCTCTTTCCGCTGACATTCGTCAGATGTTTCTGAGTATTGGAGTCAGAGAATCTGACAGGCGTTTTCAACGCATTCTATATCGTTTTTCTCCTCAACAACCATTACAAGTTTATAGTGGCCCCCCTTGGGCACATTTGGATGTCGCGCAGTGGCCTGCTGTTCCTTTTAATCCTTCCGTAGAGCCTGAGGCGCCGGAAGAAAAGAAACAGAATTTTCTCGCCGCTACTTTAAATGAAAAATCTCCTATATTATCACTAGGAGATCGTATCTCATCTTGGTCTAAACTATTGCGCAGTGTAGTTTTCGTTTGTCGATTTGTAAAATTGTTACCTCACAGATATCGCATGTCAGCATCGGATTATGAGTTCGCTGAGTTATTAATTCTTCGTGAACTTCAACGGTTTTATTTTCGCGCCGAGATCGCGAAGCTCGAGGAAGGTCAAGTTTGTAGCCCTGCTTTTCGACACTTAAAACCATTTCTTAAAGATGGACTAATTAGAGTAGGGGGACGTTTAAGAAACTCTGACTTGAGCTACGACGAGAAATATCCCATTTTGCTTCCGAGAAAAGATCCGATCTTGAATTTACTTGTCGAATATCATCATAAATTAAATTGTCACGCCGGTCCTGACCTGCTGATGGCGCTCTTACGTCAGAAGTATTGGATACTTTCTGCTCGTAATTTAATTAGGAATAGGATACACAAATGCATGCCTTGCTTTCGACTTCGTCCTAAGCCAACATTCCCTGAAATGGCGGATCATCGTTCTTGTCGTGTCGTTCAATCCGCTAAACCCTTCATTCACACGGGTACAGATTATGCTGGCCCTTTCAAGGTTACCATAACACGTGGGCGAGGTATTCGTTCTACCAAAGCTTACGTGTGTTTATTTGTTTGCATGACTACGCGCGCAGTACATATAGAACTGGCTGGTGATTTAAGCACAGCTAGTTTCATGGGAGCCTTCAAGCGGTTCCTATCTAGACGAGGCCCGGTGGGTAGAATTTATTCGGACAATGGAACGAATTATATAGGTGCTAAACGCAAGCTTTCAGAACTTCATGAATTTCTTTGTTCAAAGTATCATAATACAGAGTTTGGTCACGTCTTAGCTGAAAATCGCATTGATTGGTTCCTAAATGTACCGACAGCTAGCCATTTTGGCGGGAATTGGGAGGCTAATATCAAAAGCTTAAAGTCTCATCTATATCGCGTTATAGGTGATACAATTCTTTCATTTGAAGAGCTATGTACTGTTCTCACTCAGATCGAATCGGTAATGAACACACGACCTTTATGTAGAACACTCTCTAGTGATCCTTCAGAACCGCTTGCCTTAACTCCTGCGCATTTTTTGAATCTCATGCCTTTGAAATGCTTGCCTGCGGAAGAAATCGATGAAAATTTAATTACTCTTGCTAGACACGATTTAATAGACAAATTAGTTCAATCGTTTTGGAAGCGCTGGAGACGGGAATACCTTCATACGTTGCAATCACGCCGCAAATGGAACACGCCGGTCGATCCAGTCGTCGTCGGCTCGGTGGTGATTCTGATTAACGATAATTCGCCTCCTCTACACTGGCCTTTGGGTGTCGTGGAAGAAGTGTTTCCGGACTCTACGGGAGTTACACGCATTGCACGAGTTAAGACAGCGATCGGATCGTATTTGCGTCCCGTGGTGCGACTCTGCCCACTACCCAACCAGTAG
Protein
MESLVVDKITERLPTTTVDASLLSNFEDIELADDTYFNPGPIQLLIGASIFPHLLLSKKVQGRPSHASPIALETILGYVIVGDAPVRVASNESLSYCCTGDPLDSTIRKFWELEEVDVPSVLSPEDKMSEEFYTSTTTRDSDGRYVVALPFKGDVNTLGNSRQASESRFYCLERKMQASPQLKLAYDNIILEYLEKNYLSAVDCDSSDISYFIPHHGVIKEDKVTTKLRVVLDGSCKTTTNVSLNDLLYRGQNFQGNLFNIIINFRLFPVALSADIRQMFLSIGVRESDRRFQRILYRFSPQQPLQVYSGPPWAHLDVAQWPAVPFNPSVEPEAPEEKKQNFLAATLNEKSPILSLGDRISSWSKLLRSVVFVCRFVKLLPHRYRMSASDYEFAELLILRELQRFYFRAEIAKLEEGQVCSPAFRHLKPFLKDGLIRVGGRLRNSDLSYDEKYPILLPRKDPILNLLVEYHHKLNCHAGPDLLMALLRQKYWILSARNLIRNRIHKCMPCFRLRPKPTFPEMADHRSCRVVQSAKPFIHTGTDYAGPFKVTITRGRGIRSTKAYVCLFVCMTTRAVHIELAGDLSTASFMGAFKRFLSRRGPVGRIYSDNGTNYIGAKRKLSELHEFLCSKYHNTEFGHVLAENRIDWFLNVPTASHFGGNWEANIKSLKSHLYRVIGDTILSFEELCTVLTQIESVMNTRPLCRTLSSDPSEPLALTPAHFLNLMPLKCLPAEEIDENLITLARHDLIDKLVQSFWKRWRREYLHTLQSRRKWNTPVDPVVVGSVVILINDNSPPLHWPLGVVEEVFPDSTGVTRIARVKTAIGSYLRPVVRLCPLPNQ

Summary

Pfam
PF05585   DUF1758        + More
PF03564   DUF1759
PF18701   DUF5641
PF17921   Integrase_H2C2
PF00665   rve
PF05380   Peptidase_A17
Interpro
IPR040676   DUF5641        + More
IPR008737   Peptidase_asp_put       
IPR005312   DUF1759       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
SUPFAM
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
840
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17578
Exp number, first 60 AAs:
0.0748
Total prob of N-in:
0.00454
outside
1  -  840
 
 

Population Genetic Test Statistics

Pi
214.314821
Theta
137.981065
Tajima's D
3.613058
CLR
0.669077
CSRT
0.995350232488376
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号