SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01586
Annotation
PREDICTED:_uncharacterized_protein_LOC106109531?_partial_[Papilio_polytes]
Location in the cell
Nuclear   Reliability : 3.585
 

Sequence

CDS
ATGGCAAGACGACGATCAAAAAGCCAGTCCTTCGATGACGACGACAGTATTTTCGATCGACCAACGCGTGGTGGAATGTTTCACTTAACGGAGAATATCATCAGGAAGTTTGACGGCAAAGACAAAACTTATGCTGTAACAAAGTGGATACAAGATATAGAGGAAAATGGTGACATATTCGAGTGGACACCAAAGCAACGGTTATTAGTGGCTCGACGGTCATTAACCGGCACGGCAGCTTTGTGGTTAAATTCTGAAAAAACGTTTCCATGCTGGGATACTTTAAAGATAGCCATCAGTAAGGAGTTCCCTGACACCATAGACGCCAAGACTATTCACGAAATGATGAGTGCTAAAAAGAAAAAGTCAAATGAATCATGCATTGACTACATGTTTGCCATGAAAGAGCTTGGACGCCGAGGCAAAATGGCGGACTACGTGGCTATAAAATATGTTGTAGATGGCATACAAGATCAAGAAATAAATAAAATAATGCTATATGGAGTCACAACGTACGCTGAATTAAAGGAGAAATTAAAAATATACGAGATTTTGAAAGAAAAAATGGAGAAAGAACCTATTCACGGAAAAGAGCAGAAAATTACTAATACAAGAGAATGGTCATCAAAAGTTCGATGTTATAGCTGTGGAGAAAAGAGTCATAAAAGTGAAGATTGCCCGAAAAAGATGCAAGGAAAAAAGTGTTTCAACTGCAACGTGTTCGGCCATATTTCTTCACAATGTCCGGCAAAGGCGGAAGCGTCATCGACTACGGCTAGCAGCGCGAGAACGGAGCAGCAACCGAAACGCACGTATATCGCTACGACGCAGGAGGGCGCGAACACAATTTTCGAAAATCAATCTGACGAAGTTCACAACGCTATGAATGCTGTGATTGGCTCTGCGAACAGTACGGTGCGCGACAAATGTCATAACAGTGAGGTTGACATTTTAAAAGTAAATAAAGAATGTAAAGTGTTGAAAAAAACTTTGAAATTAGTAAAATTGTGTAATAATAACGAAATTCATGCATTAATTGATACTGGTAGTGAAGTTAATTTAGTAACCATGGACTATTATAAGCAAATAGGCTCTCCGACGTGTTTTAAAAATGTAAACACAGTTCTTACCGGTTTAGGCTCATCAAAGGTCATGTTATGA
Protein
MARRRSKSQSFDDDDSIFDRPTRGGMFHLTENIIRKFDGKDKTYAVTKWIQDIEENGDIFEWTPKQRLLVARRSLTGTAALWLNSEKTFPCWDTLKIAISKEFPDTIDAKTIHEMMSAKKKKSNESCIDYMFAMKELGRRGKMADYVAIKYVVDGIQDQEINKIMLYGVTTYAELKEKLKIYEILKEKMEKEPIHGKEQKITNTREWSSKVRCYSCGEKSHKSEDCPKKMQGKKCFNCNVFGHISSQCPAKAEASSTTASSARTEQQPKRTYIATTQEGANTIFENQSDEVHNAMNAVIGSANSTVRDKCHNSEVDILKVNKECKVLKKTLKLVKLCNNNEIHALIDTGSEVNLVTMDYYKQIGSPTCFKNVNTVLTGLGSSKVML

Summary

Pfam
PF00098   zf-CCHC        + More
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF02037   SAP
PF17917   RT_RNaseH
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR012337   RNaseH-like_sf       
IPR036361   SAP_dom_sf       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR000477   RT_dom       
IPR003034   SAP_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR041373   RT_RNaseH       
SUPFAM
SSF57756   SSF57756        + More
SSF50630   SSF50630       
SSF53098   SSF53098       
SSF68906   SSF68906       
Gene 3D
PDB
5UDZ     E-value=0.000929699,     Score=100

Ontologies

Topology

Length:
386
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00511
Exp number, first 60 AAs:
0
Total prob of N-in:
0.08390
outside
1  -  386
 
 

Population Genetic Test Statistics

Pi
18.026206
Theta
25.497619
Tajima's D
-0.857103
CLR
27.616966
CSRT
0.162341882905855
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号