SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01572
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Sodium/hydrogen exchanger      
Location in the cell
Mitochondrial   Reliability : 1.953 Nuclear   Reliability : 1.777
 

Sequence

CDS
ATGGCAGCTACAAATAAAAAACGGCCCCCAGTTCCCGGCAGCTTTACTATCCCTGGCTACGGTAGCAGCCATGGTAACGGTAAGGCAGGGGGTGCGAAGAATCCCCGGGCTACGGACAGCTACCACCAAATGACCCTGGCGACTCTCAATACCCGGACTCTGCGGCTTGACGAACATATTGAGGAACTGGAAGTGGAATTAGGAAGGATACGATGGCACGTCCTAGGGTTGTGCGAAGTCCGAAGACAGGGGGAGGACGTCATAACTCTAGACTCAGGCCACCTATTCTACTTCCGGGAAGGAGACCAACCTGGACAAGGTGGAGTTGGCTTTCTCGTCAATAAAGTCCTCACGGGCAACATTGTAGAGGTATCCAGTGTGTCGACACGGGTAGCGTACCTCATAATTAAGCTCACCGAAAGGTACTCCCTTAAGGTGGTGCAAGTATACGCACCGACTTCGTCATACTCGGATGACGATGTGGAGTTTGTGTACGACGATATCACCAGGGCTCTGCACAATACCACAAAAGCCCACTTCAATGTTGTCATGGGAGATTTTAACGCTAAAGTTGGAGTACAGACTTGCGACGAATCGGTGCTAGGATCCTTCGGTTATGGATGTAGGAACCACAGGGGGCAAATGCTAGTCAACTTCCTTCAGCGCGAGAGGCTCTTTCTAATGAACTCGTTCTTTGAAAAGAAGCCACAAAGAAAGTGGACTTGGCTAAGCCCCGACACTGTGACGAAAAACGAGATAGACTTTATTATGACGGACAAGAAACATATATTCAGGGATGTCTCTGTGATCAGCAGGTTCAATACCGGTAGTGATCACCGACTTGTCAGAGGCACACTGAATATGGACTTCAAGTTAGAACGCAGCCGTCTAATAAAGTCTACGCTTCGACCCAGCCTACATCACATGGCTGTAGATCCGGAGCAATTCCAGCTAGATCTCCACAACCGATTCGCTGCCTTGGAAACCACCACAGACGTAGACGAGGCCTTAGATGGCGTGGTGAGGACACTGAGACAAGAGGGACAGAGATTGTGTCCAAAGGGTCGTACAGGCAGAAAATCAAAATTATCATCCGAGACTCTCCGGTTAATGGAAGAAAGGCGAGAAAACACACAGGCCACACAATCAGAGAAGATGGCTCTTAGTAAGAAAATCAGGACGCTGATACGACGCGATCTCCGACGGTACAATACTCAGCGGATCAATGACGCAATTGAGCAAAACCGAGGAGCCAAGGTGTTCGTGCAGCGTCTTGGTAGAAGCCACCTTACAAAACTGACCACAAGGGATGGCCAAATTCTCGCCTCCAAACCGGAGATTCTCAAGGAAATTGAGGACTTCTACGGACGTCTCTATATTTCCAAAACCACCAAGTCTGCCTCTGACCCAGCAGATGTCCGAGCCACACTATCTCGCCACTACACCGACGAGCTGCCACAGATTAGTGTGGACGAGATCGGGATGGCTCTTGAAAATCTTAAAAACGGAAAAGCCCCGGGCGAGGATGGTGTTACTTCTGAGCTCTTGAAAGCAGGAGGTCTTCCTGTTATTATGGAGCTCCAGAAGCTCTTTAACACTGTCCTCTTTACCGGTAGAACTCCAAAGGCGTGGAGCAGGAGCATAGTTGTCCTTTTCTTTAAAAAAGGAGATAAAACACTTTTAAAGAATTATCGCCCCATCTCGCTCCTGAGCCACGTCTACAAATTGTTTTCGAGAGTCATAACGAATCGTCTCGCTCAGAGACTTGACGACTTCCAGCCTCCGGAGCAGGCAGGATTCCGAAGAGGATTTGGTACCGTGGACCACATTCACACAGTTCGGCAGATTATACAGAAGACTGAAGAGTATAATCTGCCACTATGTCTGGCGTTTGTGGACTACGAGAAAGCCTTTGACTCGATCGAGACCTGGGCTGTTCTGGAATCCTTGCAGCGGTGTCAAGCTGACTGGCGATACATCGATGCAATAAGATGCCTGTACGATGCCGCTACAATGACCGTCCAAGTACAGAAAGAGCAGACGAGACCAATCCAGTTGCGCAGAGGTGTAAGACAGGGGGATATTATATCCCCGAAACTGTTTACAAACGCACTGGAGGACGTCTTCAAGACTCTGGACTGGAACAGACGCGGCATTAACATAAACGGCGAGTACATCTCACATCTTCGCTTTGCCGATGATATCGTCATCATGGCGGAATCGCTGCAGGACCTACAAGAAATGGTGCACAGCCTTAATACTGCATCCCAACGGGTTGGCCTCGGAATGAACTTGGATAAAACCAAGGTAATGTTTAACGGAAACGTCATTCCGAGACCAATCGATGTGGATGGTACACCTCTCGAAGTTGTTCAAGAGTATGTCTACCTAGGACAGACCCTACAACTAGGTAGAAACAACTTTGAGAAGGAGGTGACCAGAAGGATTCAGTTGGGCTGGGCAGCGTTCGGGAAGCTTCGTCAGGTCTTTTCGTCGCCCATACCACAATGTCTGAAGACAAAGGTCTATAATCAGTGCGTCCTACCCGTGCTTACCTACGGAGCCGAAACGTGGACACTGACTGTGCGACTAGTCCACCAACTAAAAGTTACTCAGCGAGCTATGGAGCGAGCTATGCTCGGTTTGTCATTGCGAGACCGAATACGCAATGAGGTCATTCGGGCAAAGACCAAAGTGATCGACATAGCTCGCAGAGTTAGTAAGCTGAAGTGGCAGTGGGCTGGTCACATAAGTCGCAGAACCGATAACCGTTGGGGTAGACGTGTTCTGGAGTGGAGACCGCGAACCGGCAAACGTAGTGTAGGACGCCCTCCTGCTAGATGGAGCGACGACCTACGCAAGGCAGCTGGCAGTAACTGGATGCGTAGAACCGAAGATCGGGTTCAGTGGCGAGCTTTGGGGGAGGCCTATGTCCAGCAGTGGACTGCCGCAGGCTGA
Protein
MAATNKKRPPVPGSFTIPGYGSSHGNGKAGGAKNPRATDSYHQMTLATLNTRTLRLDEHIEELEVELGRIRWHVLGLCEVRRQGEDVITLDSGHLFYFREGDQPGQGGVGFLVNKVLTGNIVEVSSVSTRVAYLIIKLTERYSLKVVQVYAPTSSYSDDDVEFVYDDITRALHNTTKAHFNVVMGDFNAKVGVQTCDESVLGSFGYGCRNHRGQMLVNFLQRERLFLMNSFFEKKPQRKWTWLSPDTVTKNEIDFIMTDKKHIFRDVSVISRFNTGSDHRLVRGTLNMDFKLERSRLIKSTLRPSLHHMAVDPEQFQLDLHNRFAALETTTDVDEALDGVVRTLRQEGQRLCPKGRTGRKSKLSSETLRLMEERRENTQATQSEKMALSKKIRTLIRRDLRRYNTQRINDAIEQNRGAKVFVQRLGRSHLTKLTTRDGQILASKPEILKEIEDFYGRLYISKTTKSASDPADVRATLSRHYTDELPQISVDEIGMALENLKNGKAPGEDGVTSELLKAGGLPVIMELQKLFNTVLFTGRTPKAWSRSIVVLFFKKGDKTLLKNYRPISLLSHVYKLFSRVITNRLAQRLDDFQPPEQAGFRRGFGTVDHIHTVRQIIQKTEEYNLPLCLAFVDYEKAFDSIETWAVLESLQRCQADWRYIDAIRCLYDAATMTVQVQKEQTRPIQLRRGVRQGDIISPKLFTNALEDVFKTLDWNRRGININGEYISHLRFADDIVIMAESLQDLQEMVHSLNTASQRVGLGMNLDKTKVMFNGNVIPRPIDVDGTPLEVVQEYVYLGQTLQLGRNNFEKEVTRRIQLGWAAFGKLRQVFSSPIPQCLKTKVYNQCVLPVLTYGAETWTLTVRLVHQLKVTQRAMERAMLGLSLRDRIRNEVIRAKTKVIDIARRVSKLKWQWAGHISRRTDNRWGRRVLEWRPRTGKRSVGRPPARWSDDLRKAAGSNWMRRTEDRVQWRALGEAYVQQWTAAG

Summary

Similarity
Belongs to the monovalent cation:proton antiporter 1 (CPA1) transporter (TC 2.A.36) family.
Feature
chain  Sodium/hydrogen exchanger
EMBL
FJ265542    ADI61810.1    FJ265550    ADI61818.1    FJ265545    ADI61813.1    + More
FJ265549    ADI61817.1    FJ265544    ADI61812.1    FJ265543    ADI61811.1    FJ265551    ADI61819.1    KZ149907    PZC78256.1    ODYU01004088    SOQ43598.1    FJ265564    ADI61832.1    FJ265561    ADI61829.1    GBBI01004876    JAC13836.1    FJ265562    ADI61830.1    FJ265563    ADI61831.1    MRZV01002136    PIK34564.1    JARK01001655    EYB84321.1    JARK01001565    EYB89683.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001337    EYC34625.1    GDKW01001596    JAI54999.1    GBBI01004877    JAC13835.1    JARK01001354    EYC21986.1    JARK01000173    EYC41342.1    JARK01000388    EYC37469.1    JARK01001370    EYC16150.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    ODYU01008249    SOQ51673.1    JARK01001621    EYB86109.1    JARK01000460    EYC36749.1    JARK01001626    EYB85833.1    JARK01001340    EYC30828.1    JARK01001711    EYB81734.1    JARK01001353    EYC22263.1    DS268591    EFO92565.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    DS268444    EFP01729.1    JARK01001730    EYB81048.1    EYC16376.1    JARK01001543    EYB91356.1    JARK01001438    EYC02111.1    GBGD01000453    JAC88436.1    GBGD01000380    JAC88509.1    JARK01001395    EYC09730.1    EYC09729.1    JARK01001505    EYB94618.1    JARK01001389    EYC11015.1    JARK01001459    EYB99276.1    EYB99275.1    EYB94617.1    JARK01000063    EYC44387.1    EYC33297.1    JARK01000109    EYC42952.1    JARK01001407    EYC07212.1    JARK01001639    EYB85201.1    JARK01000302    EYC38674.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001470    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01001497    EYB95322.1    JARK01001612    EYB86585.1    EYC10874.1    JARK01001421    EYC04912.1    JARK01001401    EYC08686.1    JARK01000343    EYC38099.1    EYC30744.1    JARK01001344    EYC28216.1    JARK01001372    EYC15614.1    EYC03125.1    JARK01001475    EYB97550.1    JARK01001581    EYB88505.1    JARK01000008    EYC46079.1    JARK01001500    EYB95049.1    JARK01001582    EYB88498.1    JARK01001531    EYB92324.1    JARK01001618    EYB86258.1    JARK01001346    EYC26445.1    JARK01001357    EYC20551.1    JARK01000161    EYC41641.1    DS268655    EFO97114.1    JARK01000177    EYC41210.1    EYC41209.1    JARK01000165    EYC41537.1    JARK01001524    EYB92970.1    JARK01001343    EYB95040.1    EYC28825.1    JARK01000146    EYC42042.1    JARK01001637    EYB85284.1    JARK01000347    EYC38051.1    JARK01001568    EYB89432.1    EYB85282.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF10328   7TM_GPCR_Srx
PF00999   Na_H_Exchanger
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR001507   ZP_dom       
IPR019430   7TM_GPCR_serpentine_rcpt_Srx       
IPR017452   GPCR_Rhodpsn_7TM       
IPR018422   Cation/H_exchanger_CPA1       
IPR006153   Cation/H_exchanger       
IPR004709   NaH_exchanger       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=7.81316e-05,     Score=114

Ontologies

Topology

Length:
985
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01813
Exp number, first 60 AAs:
0.00015
Total prob of N-in:
0.00057
outside
1  -  985
 
 

Population Genetic Test Statistics

Pi
263.862379
Theta
138.331885
Tajima's D
1.378814
CLR
359.836602
CSRT
0.755562221888906
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号