SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01562
Annotation
PREDICTED:_uncharacterized_protein_LOC106122315_[Papilio_xuthus]
Location in the cell
Nuclear   Reliability : 3.556
 

Sequence

CDS
ATGGTGGAGGTTGCTACTAGGGAAAGTAGAATGACGGTACGAGTTGGCGCTTCTCTCACTGATGAGTTTGACGTTGTGACTGGACTCAGGCAGGGGGACGCTCTGTCACCAATGCTGTTCAACCTGGCACTTGAACACGCCATACGGAAAGTGAACACACTTAGTGGCGGAGTGTGGCTCAACGGACAGCATAGGGTGATAGGATATGCCGATGACCTCGCTCTACTTGGAGAAAGAAAGCAGCACGTTATAGACGCACTCAACTGCCTCCAACAAGAAGCCTCTCGGATTGGCCTTCGCGTGAGCCACGAGAAGACAGAATATCTTCACATGCGTCGATATAAAAACGTAAGACGGAAGCGAGAAGACCTAGTGGTGGGAAATACGAGGTTCAAAGGAGTGGCTAAATTCCGGTACCTTGGCTGCACTGTAACAGACACCAATGACAGGGAAGATGAAATCGAAATTCGTATACAAAATACCCTACGATGCAGTGCAGCCCTACACCCGGTTCTCTCTTCGAAGCTACTAAGCAGGCGCACCAAGATTCGGATATACAAGACTCTAGTCAGACCGATCCTATTGTATGGATGCGAAGCATGGACGCTCACACAGAAAGAAGAGGCAAAACTTCTCGTGACGGAGCGAAAGGTATTGAGAAAAATACTAGGACCAGTTCGGAAAGAAGACGGTTCTTGGCACGTCCGGAAAAATAAGGATGTGGAGAGGCTTTTTGGTGAGCCAAATATTCTGGGGGAGATGAAGGCACGGAGGCTCGGATGGCTCGGACATGTAGTACGTATGGAGCAGGATCGGGCTGTGAAACGGGTGTACACGGGTGTACCGGAGGGACGCCGCCCCGTAGGGAGGCCCAAGTACCGCTGGTGTGACGCTGTGGAAGGAGATTTACGGGAGCTCCAAGTGTCGGACTGGCAAGGTGTTGCGCAGCGCCGGGATGAATGGCAAAGTTTATTGTCGGAGGCCAAGACCCACTTCGGGGTCATAGCGCCAGCTCAGTAG
Protein
MVEVATRESRMTVRVGASLTDEFDVVTGLRQGDALSPMLFNLALEHAIRKVNTLSGGVWLNGQHRVIGYADDLALLGERKQHVIDALNCLQQEASRIGLRVSHEKTEYLHMRRYKNVRRKREDLVVGNTRFKGVAKFRYLGCTVTDTNDREDEIEIRIQNTLRCSAALHPVLSSKLLSRRTKIRIYKTLVRPILLYGCEAWTLTQKEEAKLLVTERKVLRKILGPVRKEDGSWHVRKNKDVERLFGEPNILGEMKARRLGWLGHVVRMEQDRAVKRVYTGVPEGRRPVGRPKYRWCDAVEGDLRELQVSDWQGVAQRRDEWQSLLSEAKTHFGVIAPAQ

Summary

EMBL
PYGN01000510    PSN45119.1    GECU01011157    JAS96549.1    PYGN01000078    PSN55011.1    + More
PYGN01000451    PSN46127.1    PYGN01000287    PSN49259.1    PYGN01000629    PSN43121.1    HE799691    CCH14900.1    PYGN01000047    PSN56294.1    PYGN01000070    PSN55417.1    PYGN01000203    PSN51319.1    PYGN01000064    PSN55609.1    PYGN01001382    PSN35227.1    PYGN01000324    PSN48495.1    PYGN01000020    PSN57453.1    PYGN01000219    PSN50892.1    PYGN01001004    PSN38555.1    PYGN01000836    PSN40188.1    GGMR01016675    MBY29294.1    PYGN01003402    PSN29545.1    PYGN01000082    PSN54842.1    GGMR01000301    MBY12920.1    AJVK01001578    GGMR01000126    MBY12745.1    PYGN01000502    PSN45243.1    GGMR01014652    MBY27271.1    PYGN01000372    PSN47498.1    GBBI01004199    JAC14513.1    PYGN01000580    PSN43876.1    GBBI01004198    JAC14514.1    FJ265555    ADI61823.1    GBHO01016952    JAG26652.1    GBBI01004263    JAC14449.1    QOUI01000020    RCK67885.1    RAPH01000014    RNL66055.1    GDAI01000742    JAI16861.1    AAZX01023614    GDHC01021627    JAP97001.1    GBRD01000202    JAG65619.1    PYGN01000107    PSN54137.1    GECZ01011079    JAS58690.1    GGMR01011466    MBY24085.1    GECU01026439    JAS81267.1    ABLF02027703    ABLF02061609    KU311054    ALX81665.1    GGMR01006433    MBY19052.1    GGFJ01005240    MBW54381.1    PYGN01000613    PSN43351.1    ABLF02009558    ABLF02041313    ABLF02057180    PYGN01001494    PSN34463.1    GBGD01000331    JAC88558.1    GBRD01017846    JAG47981.1    GECL01002632    JAP03492.1    PYGN01000119    PSN53667.1    GBBI01004261    JAC14451.1    PYGN01001321    PSN35706.1    GGFK01003183    MBW36504.1    GAKP01022638    GAKP01022636    GAKP01022635    JAC36314.1    GECL01001585    JAP04539.1    ABLF02019049    ABLF02067155    CH902961    KPU72636.1    ABLF02026145    ABLF02026146    ABLF02042729    ABLF02003877    ABLF02042991    PYGN01000106    PSN54154.1    GGFK01002196    MBW35517.1    GGFK01002192    MBW35513.1    QOIP01000003    RLU25142.1    LBMM01005351    KMQ91586.1    ABLF02009557    ABLF02016497    ABLF02041567    ABLF02062088    GBRD01011073    JAG54751.1    CH905131    KPU81852.1    GGFK01003613    MBW36934.1    ABLF02011153    ABLF02057094    GGFK01005184    MBW38505.1    GGFK01001798    MBW35119.1    GGFK01001949    MBW35270.1    GGFL01003846    MBW68024.1    CH902619    KPU76535.1    GECU01035086    JAS72620.1    GGMR01020071    MBY32690.1    GGFL01003845    MBW68023.1    ABLF02019047    GGMR01010991    MBY23610.1    CH902657    KPU75308.1    CH902653    KPU74858.1    CH902626    KPU79149.1    ABLF02039015    IAAA01017080    LAA06072.1    CH902621    KPU81727.1    NEVH01016288    PNF26362.1    PYGN01000212    PSN51056.1    ABLF02066124    CH904714    KPU81814.1    HACL01000173    CFW94467.1    QOIP01000009    RLU18885.1    GBBI01004262    JAC14450.1    IAAA01017079    LAA06070.1    PYGN01002509    PSN30365.1    ABLF02017398    AZNE01000717    KID80942.1    PYGN01000254    PSN50032.1   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
PF13873   Myb_DNA-bind_5
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR028002   Myb_DNA-bind_5       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
339
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02489
Exp number, first 60 AAs:
0.0025
Total prob of N-in:
0.04699
outside
1  -  339
 
 

Population Genetic Test Statistics

Pi
299.118527
Theta
147.378558
Tajima's D
2.968487
CLR
1.516019
CSRT
0.976501174941253
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号