SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01559
Pre Gene Modal
BGIBMGA010729
Annotation
hypothetical_protein_AB894_15365?_partial_[Piscirickettsia_salmonis_LF-89_%3D_ATCC_VR-1361]
Location in the cell
Nuclear   Reliability : 2.488
 

Sequence

CDS
ATGAAAACCGATTCCAACAACTATCCTACATACGCGGAATATGTTAGGCGATCTTTATTGCGTCTTCGTATAGTAAATGGACTTAGTGACGAATTAGTTTCAGCAATAGTGATCCGAGGTATCGTTGATCCACAAATTCGTGCGGCCGCTACAAACGCGAGGTTATTGCCTAACGATTTAGTTGAGTTTTTCTCCATATATGTAAAGCCTACACCTCAAACAAAAACAAATCATAATACTCGCACTGTAGCTGGTCGCTTTCATAATACACAATTCTCATCACGTAAAAGAGAGCATAGTTCTAGTAGAACCGGTTGTTACGTATGTGGATCATTTGGCCATAGACAAGTGAATTGCCCTAAGCGAACGAGAAAACGTTCGCCTACTGTGAATGATAGATTCACATCTGTACCCGCTGCCAGCTCCTCTGTGCAGAAGCCTGAACCTTGTTCTTTTTGTAAAAAGCTGGGCCGTAAAGTAGAGCAGTGTTTCTTTAAGCAGCGTTCTGAAGCTCGAGGAAAATCTAACGTGAATTTTTGCCGTGATACTGTAAATGACTATAGAAAAAATGATATAGCTACTGCGATCGTACAGGGTGTACCAGTCGATATCCTGATAGATAGTGGATCCACAGTCTCGCTTATGTCTGAATCAATTGTAAAACATTTTCAATGTAAACGAGTACCCTCATTTTGCGTGTTACGAGGAATTGGTGACTGTGATACTGAATCTCGCTATTTTACTACTTTGACAGTTGAGTTTCCCGAAATCACACTAGAAATAGACTTTCAAATTGTTAGTGACAAGTTCATGAATACTCCAGTCATAATCGGTACTGACGTTTTGAATCGGGAAGGTGTCACGTATATTAGGAAAAAGGGCATACAGCGCTTAACTCGGGTAGAAAAGGTTTTTACTGCTGAGACAACTGAACTTAATTCAATCCCTACCGTGAATACTTCATTAACAGGTGAAGAAAAAAATAAATTATTAGCTTTGGTACGAAAATTTTCAAAATACCTTATAACTGGTACCGCGGCCAGTACTGTTACAACTGGATCCATGCAAATTCGACTCAGCAATGAAACTCCTATTGTTTACAGACCTTACAAATTATCATTTAGCGAAAAACTTCGCGTTAGAGAAATTATTAAAGATCTTCTTGATAAAGGTGTGATTAGGGAGTCTGAATCGGAGTTCTCGAGTCCGATATTGCTAGTTAAGAAAAAGGACGGCAGTGACAGGATGTGCGTGGACTTTCGGGCTCTTAATGCGAATACTGTGAAGGATCGCTATCCATTGCCGTTAATAGACGATCACATTGACCGGTTAGGTAGCGCAAAATATTTTACAAGCCTCGATATGGCCACTGGTTTCCACCAGATTCCTTTAGCAAACGACTCCATTCACAAAACCGGTTTTGTGACACCCGAAGGTCATTTTGAATACCTTAAAATGCCCTACGGGTTAGCCAATGCCCCGGTTGTTTATCAACGTATTATAACTAATACTCTGAAAGCCTTTAGTGAGACAGGGAGGGCTTTAATCTATATCGATGATGTTTTAATACCTAGTCAGACCATTGATGAAGGCCTAAATACTCTGCGTGAAATCTTTGAAACACTAACTAAGGCGGGCTTCTCAATTAATTTAAAAAAATGCAAGTTTCTTGCTAACGAAATTGAATATTTGGGCAGAACTATCAGCAATGGTCAGGTTAGGCCGAGTGCGTATAAAGTAGAAGCATTGACAAGAGCCCCGAAGCCTGGTAATGTTAAACAAGCTAGACAATTTTTAGGTCTAGCGGGTTATTTTCGGCGCTATATTCCTGCATATTCGTTGCAGACAGCTTGTATTTCTAATCTGTTTCGTAAAGGTGTTGAGTTTAAATGGGGTGATGAACAGGAACAAGTACGCCAGTATATAATTACGCGTTTAACCAGTGAACCTGTCCTCAATATATTTAATCCATCATTATTAACAGAAGTACACACTGATGCTTCTTCTCGAGGGTATGGAGCTGTTTTACTTCAGACTCATGGGAATAATAATAAACGCGTGGTGGGATATTTTAGTAAAGTTACCCAAGGCGCCGAACCACGCTATCACTCCTATGAGCTGGAGACACTCGCTGTGGTCAAGGCTCTGCAGCATTTCAGGCACTACCTCATAGGTATACATTTCAAGGTAGTTACAGACTGCAACGCTTTGAAGCTTACCCAACGTAAAAAAGATTTACTACCGAGAGTCGCTCGGTGGTGGATCTACTTACAAGATTATGATTTTTCGTTAGAGTATCGTAAGGGCGCTGTGCTATCTCATGCCGACTATCTAAGTCGTAATCCTATAAATGTTTGTGAAATTGGTAGACCGCATAACTGGGCACAGATAGCACAGAGTGCTGATGAAGAAACTCGGAATTTAATACAAAAGTTACAAAACGGTGAATTAGATGAGACACGCTATGTAACTAAAAATGATGTTCTTTATTATAAATTTGATTCTGTTGGCCAACCTAGTAAATTATTATGTTATATTCCAAGAGGACATCGCCTCAGTTTGTTACGAATCTTTCATGATGAGCATCATCATATTGGAGTAGATAAGACGCTTGATCTAATATTAAACCATTTTTGGTTTCCTAGTCTAAGACAATTTGTTCGTAAATATGTACGCCATTGTATAGTATGTCTTTCACACAAAAAAATACCACGTCAACCCTTGCAGCCGATCGAGTCGTGGAAGAAACCGGACGTACCCTTTGACACGGTACATAGTGATGTCTTGGGTCCTCTTCCCGAATCGAACGGTTACAAATTTGTTGTCTTGATAATTGACGCTTATAGTAAGTTCTGTCTACTAAATCCTATGCGTAAGCAGGATGCAACAGAGTTAAAATTAGTATTTGAAAACGCTGTATCTTTATTTGGTGCACCTAGGCAGATTGTAACCGATAGGGGTAGAATGTACGAAAATAGATCATTTAGACAATGGGTATCAGACGTAGGTAGTAATTTATTCTTTATAACGCCAGAGATGCACCAGAGTAACGGTCAGGCTGAGAGATATTGCAGAACAGTTCTTAATATGATTCGTGTGGAGGTAAATTTCAGAAACGAAAATTGGTCAGAAGTTTTGTGGAAACTGCAGCTCACCCTGAACGTTACGAAACAAAAGTCCACTCAATATTCACCTTTATATTTGTTAATTGGTAGCGATGCTGTGACGCCCGTCATTCGTTCCGTTGTACGCGATGTGGCTCTAGAAGGAACAAGTGCCAACAGAGAAACCTTACGCGAGCTTGCCCGACAAAGAGCTTCTCAACTGCTGGACAAAAACCGAAAACAGCAGGACACTCGAGTAAATGAACGGCGCAAACCCCCGCGTACTTTCCATGAAAACGACGTGGTCTTCGTGCATAAGAATAGCCAGTCTGTTGGAAAGCTGGATTCTGGTATGCGTGGCCCGTACAAAATAGTGCGTGCGCTGCCACATGGACGTTATGAACTGAAGCTTCTTTCTGGCTCACTTGGGAAGACCACGGAAGCTGCTGCCGAATTTATAAGTGCCTGGCACGGAGAGTGGACGCCGGATGTGTGCACCGCATTTTTCGAGTGTGATGAGAATAGCTCTGAGGAAGGTATTGTCGCCGGTCCATCACACCGCCATGACGACATAGTACCTCTAGACGGACCTATTAATGCGGGCGAGGACGCTCCGCCGTCAGGAGAGGCCGTGTTAGAAGATGATGATGACATTGGAGGCGTGGCCTAA
Protein
MKTDSNNYPTYAEYVRRSLLRLRIVNGLSDELVSAIVIRGIVDPQIRAAATNARLLPNDLVEFFSIYVKPTPQTKTNHNTRTVAGRFHNTQFSSRKREHSSSRTGCYVCGSFGHRQVNCPKRTRKRSPTVNDRFTSVPAASSSVQKPEPCSFCKKLGRKVEQCFFKQRSEARGKSNVNFCRDTVNDYRKNDIATAIVQGVPVDILIDSGSTVSLMSESIVKHFQCKRVPSFCVLRGIGDCDTESRYFTTLTVEFPEITLEIDFQIVSDKFMNTPVIIGTDVLNREGVTYIRKKGIQRLTRVEKVFTAETTELNSIPTVNTSLTGEEKNKLLALVRKFSKYLITGTAASTVTTGSMQIRLSNETPIVYRPYKLSFSEKLRVREIIKDLLDKGVIRESESEFSSPILLVKKKDGSDRMCVDFRALNANTVKDRYPLPLIDDHIDRLGSAKYFTSLDMATGFHQIPLANDSIHKTGFVTPEGHFEYLKMPYGLANAPVVYQRIITNTLKAFSETGRALIYIDDVLIPSQTIDEGLNTLREIFETLTKAGFSINLKKCKFLANEIEYLGRTISNGQVRPSAYKVEALTRAPKPGNVKQARQFLGLAGYFRRYIPAYSLQTACISNLFRKGVEFKWGDEQEQVRQYIITRLTSEPVLNIFNPSLLTEVHTDASSRGYGAVLLQTHGNNNKRVVGYFSKVTQGAEPRYHSYELETLAVVKALQHFRHYLIGIHFKVVTDCNALKLTQRKKDLLPRVARWWIYLQDYDFSLEYRKGAVLSHADYLSRNPINVCEIGRPHNWAQIAQSADEETRNLIQKLQNGELDETRYVTKNDVLYYKFDSVGQPSKLLCYIPRGHRLSLLRIFHDEHHHIGVDKTLDLILNHFWFPSLRQFVRKYVRHCIVCLSHKKIPRQPLQPIESWKKPDVPFDTVHSDVLGPLPESNGYKFVVLIIDAYSKFCLLNPMRKQDATELKLVFENAVSLFGAPRQIVTDRGRMYENRSFRQWVSDVGSNLFFITPEMHQSNGQAERYCRTVLNMIRVEVNFRNENWSEVLWKLQLTLNVTKQKSTQYSPLYLLIGSDAVTPVIRSVVRDVALEGTSANRETLRELARQRASQLLDKNRKQQDTRVNERRKPPRTFHENDVVFVHKNSQSVGKLDSGMRGPYKIVRALPHGRYELKLLSGSLGKTTEAAAEFISAWHGEWTPDVCTAFFECDENSSEEGIVAGPSHRHDDIVPLDGPINAGEDAPPSGEAVLEDDDDIGGVA

Summary

EMBL
GDHC01004980    JAQ13649.1    GBHO01030786    JAG12818.1    LBMM01008871    KMQ88569.1    + More
EF710649    ACE75273.1    GBHO01036023    GBHO01032007    JAG07581.1    JAG11597.1    GBYB01013920    JAG83687.1    GBHO01040010    GBHO01001812    JAG03594.1    JAG41792.1    KQ971338    KYB27887.1    KYB27888.1    KQ460883    KPJ11409.1    ABLF02008401    ABLF02008404    LBMM01010976    KMQ87102.1    LBMM01005919    KMQ91096.1    KMQ91095.1    GEGO01004299    JAR91105.1    GGMR01009949    MBY22568.1    GEZM01033083    JAV84424.1    ABLF02004401    ABLF02013544    ABLF02013550    LBMM01011782    KMQ86633.1    ABLF02033943    ABLF02042737    GGMR01016004    MBY28623.1    GGMR01003388    MBY16007.1    GAMC01007326    JAB99229.1    GFXV01005120    MBW16925.1    GEHC01000888    JAV46757.1    GBBI01004477    JAC14235.1    ABLF02041876    GAMC01015907    JAB90648.1    ABLF02003120    ABLF02004015    ABLF02057179    ABLF02066208    GGMR01005091    MBY17710.1    GAKP01014483    JAC44469.1    GBBI01004551    JAC14161.1    ABLF02005846    GBBI01004550    JAC14162.1    GFTR01008753    JAW07673.1    GBXI01005773    JAD08519.1    GEHC01000930    JAV46715.1    ABLF02014660    ABLF02042774    GBXI01004632    JAD09660.1    GAKP01016237    JAC42715.1    GGMR01015682    MBY28301.1    GAKP01001563    JAC57389.1    KA649989    AFP64618.1    GAKP01008942    JAC50010.1    GAKP01016235    JAC42717.1    ABLF02017401    GBXI01015151    JAC99140.1    GEHC01000880    JAV46765.1    GAMC01020207    JAB86348.1    GBBI01004549    JAC14163.1    GBBI01004613    JAC14099.1    GEHC01000876    JAV46769.1    GEHC01000891    JAV46754.1    GAKP01019383    JAC39569.1    KQ971370    KYB25609.1    KYB25610.1    GGFK01005990    MBW39311.1    GGFL01001689    MBW65867.1    ABLF02005127    ABLF02005129    ABLF02007401    GACK01009547    JAA55487.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00077   RVP
PF00665   rve
PF00098   zf-CCHC
PF17917   RT_RNaseH
PF14392   zf-CCHC_4
PF13873   Myb_DNA-bind_5
PF02037   SAP
PF03732   Retrotrans_gag
PF16064   DUF4806
PF09668   Asp_protease
PF12384   Peptidase_A2B
PF07530   PRE_C2HC
PF03273   Baculo_gp64
Interpro
IPR001969   Aspartic_peptidase_AS        + More
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR018061   Retropepsins       
IPR036397   RNaseH_sf       
IPR036875   Znf_CCHC_sf       
IPR041373   RT_RNaseH       
IPR034122   Retropepsin-like_bacterial       
IPR025836   Zn_knuckle_CX2CX4HX4C       
IPR028002   Myb_DNA-bind_5       
IPR036361   SAP_dom_sf       
IPR003034   SAP_dom       
IPR005162   Retrotrans_gag_dom       
IPR032071   DUF4806       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR024650   Peptidase_A2B       
IPR004955   Baculovirus_Gp64       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF68906   SSF68906       
Gene 3D
PDB
4OL8     E-value=3.69269e-77,     Score=738

Ontologies

Topology

Length:
1257
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.428560000000001
Exp number, first 60 AAs:
0.40045
Total prob of N-in:
0.01960
outside
1  -  1257
 
 

Population Genetic Test Statistics

Pi
249.224472
Theta
167.565211
Tajima's D
0
CLR
21.157146
CSRT
0.365481725913704
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号