SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01554
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 4.185
 

Sequence

CDS
ATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGTGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTCAGCGTAATTTGTTACGCTGACGACACGTTGGTCGTAGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACCAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGCTCTTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTTGAACTGGATGGTCGGTGGAACTTCCGCGCTCACTTTGCGAAGTTGGGCCCTCGACTGATGGCGACGGCCGGCTCTTTGAGCCGGCTGCTTCCAAACGTCGGGAGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGGGCTCCCGTATGGTGCCACGCCCTGACCCGCAAGAACGTCGCGGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACGGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGTGACCTTCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACACAGATGTTGACCGGCCATGGGTGTTTTGGCCGGTACCTCTTTAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATATCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGAGGGTACCTCCCGCTCCGCGGGGGAGAATCCCTCCGTGCGGTCGAGCGATCGGCCGCACGCTGCCCCACCGTTTCTGGGGGGGCAAACACTGCCACGAGGAAGGGGGCGACAGCACGGGTCGCGTAAGGGACAGAGTCCCCACCGTGCGCCTTGAGCGCTGCGAGAGCCTGATCTCGCTGTACTCGGCGCGGAGCTCCGCAAGGGGCGATGCGTCTAGTGGGCGGGAGACGCCAGCGCTGTTTGCCGATTGCGTTCGGCAGCGGACTCGGCGGAAGCGGAAGTCGGCTCGTCGGCCGGCGTCCTCCGCTCCGTCCGACTCCTCGGAGGGTGAGCCCGCCAGCGCCAAATATATGGCGATGGCGGAAGGGCCGGCGGCTGCTGCGGCGCCGCCTGCCACCAATTGTGACATTTCTTCCCGCGGACTGGACGCTGCCTCCTCGGCGCAGTCTAGGGCCGCCTGCCGCAAGGCAAAGAACGGGACAGAGGTAGGAGAGGTCGAGCGTCTGGAGCGTTCCCTGACGGAGGTGGGTCCCTATGACCCCCTCCGTAGATTGAACATTATCCAGAAACTTGTGTCTGCGGTGGCGACGAAGTCGAGCGCGGGCTTAAAGGGTGATTACCTACGGGCCCTCAAATCCTCAGCCGCCTCGATGGAGGAGATATTGGTGGAGGTGGTGGAGCGCACGACTGATAAGGAGAACGCGGACCTGCGGCGAGAGCTGGACCTGATGCACGCCCGCTTTGCGCAGGTTAGCGAAGAGAACGGCCACCTGCGAGCTGAAAACGGCCAAATCAAGGTCGATATGGCAGAGCTGCGCACGGTGGTCAACGACCTGCTAGAGAAGCAGCGCAGCTCGGCCCCCGTTCCCCCTCCGCCCGAAGTGGAAGATGAAAGCGAGGCCGAAGAGCTGAGGCGGCAACTCTTAATCTCGGAGGCACGCAGCTCCAAGGTGGAGCGTGCGAGACCGCCCCTCGCTCACGAGGCGAAAGGCGCTGCCCCCACACCGGCACCCCGAAAGAAAATGGCCGCAAAAACATATGGCGGTCCCAAAAAGGATGCGACACCAGCGGCACGTTCGGCCGCTTCAGCTGCTGCTCCGGCCAAACCCGGATCATCGGCAAAGGATACGGGGGCACCAAAACCCGCCCCCTCAAGGGCACCTATCACCGGCCAGCCCAAGACCCAGAAGGCCGCTCCTGCCCCGTCCCAGCCTGCGAAGGTGGGGCCCGGCAGGAGCCGGAATAAAAAGAAGGGGGGCGTCAACGCCGCCAAACCGGCACCGACTCCCCAGCCCCGCCCTCTGCCCCCGGCCCCAGCAAATATGGATGAGGCCTGGACGACGGTAGTGCGGCGTGGGCCTAAGAAAGTAGCGGCGCCTCCTGCGCCGCGTCCCAAGCCCGCCCCTGCGGCCACCGCTCCCCGCCAAGAGGGTCGAGCGGAGCCGAGGGGCCGAAATGGACGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGTGCTAGTGGAGCTGCTGCCGGCCGGCAAAGAAAAGGGCATCACCTACCACGAGGTGATGACCCAGGCGCGCGGCGGCGTGAATGTGGACGCCCTCGGCGTGGAGGGGGGCATCAAGGTCCGGCAGACGGCCAACGGGGCCCGTCTCATAGAGTGCCCCGGCCCGAACACCAACGCCGCGGCCGAAAAATTGGCGGCCCGGCTGAGGGAGATTCTGCCGGACCCCGAGGTGGTGCGCATCGCGCGGCCCGTGAAGATGGGAGAAGTCAAAATCACGGGCCTCGACGAGTGCGCAACTAAGGAGGAGGTCGCCGCGGCCATCGCGTCGCAGGGCAACTGCGCCCTCGCCGACGTCAAAGTCGGAGAGCTCCGGGTGACATATTCCGGAACCCGGACGGCGTGGGCGCGTTGCCCGATTGCAACGGCGACCCTCCTGGCCACCCCTCCACAGGGGCGGCCTTCCGACAGCCCAGGAAGGCTGCGCGTGGGCTGGGTAGTGGCTCACGTGCAGCTGCAGGATGCCAGGCCGTGGCGCTGTCTTCGGTGCTTCGGCACCGGCCACGGTCTCGCCAAGTGCCCCTCGACCGTGGACCGCAGCGGCTTGTGTTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCACAGCCGCGCCGCACTGCGTCTTGTGCGACGCGGCCAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGTAAATCCGCCCCCTCCTCTACAAAAACGAGGAGGGGCGGAAAGAAAAAGAAGCCGGCTGCAAAAAGGGCAGCCGGTGAGTCAGCTCCCGCCGCGGCACCAGTGCAGCCGCAAGGCGGGACAGACGAGGGAGCGATGGATGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGACGTCGCTGTCGCCGCGGAGCCGTACTTCGTCCCCACCGACCAGGACTGCTGGATGGGGGACGTCGACGGCTCCGTGGCCATTGTGTTGAGACAGTCCGCGGCGTTACCCCCCTTGGAAATGGTGGCCAGGGGACCCGGGTACGTCGCGGCTAGGATCGACGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGAGCCTCGCCGAGTTCGAGCGGTTTCTGGGCGGGCTCGAGGCGCTTTTACACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACGTCAATGCCAAGTGCACGGCTTGGGGTTCCCCCCGCACGGATGCGAGAGGCGAGGCCCTTTCGGAGTGGGCGATCGCGACCGGCCTCTGTCTCCTAAACAGAGGCACGGTCGCGACTTGCGTGCGGTGGAACGGGCAATCTCACGTGGACGTGACGTTCGCGTCCCCGTCCGCCGTGCGCCGCACCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTCGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGCGGGCGCCCGCGGTGAGGAGGAGCTCCCGCAAGGTGCGCCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGAATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCGAGACTCCGTGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACTGCCGCCGCCGTCGTCGCGACGCTACGTTCGCGGAGACGGCGGCCCGGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAACCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGACTCGGCAGCTGCGGGAAATTGTTGCGGCACTCTTCCCGCCGGCAGCGGGGGGGGACTTTGAGCCTCCCCAGATGGACGCCACGTGGGGCACGCCTCCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAGAATGAGAGCGAAGGACGCGGCCCCCGGCCATGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTGGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCTGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGAATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGATGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCTTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCAGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTCAGCGGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACCAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGCTCTTTCACGGGCCGGGACGAGCGCCGCCTGTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACTTTGAGAAGTTGGGCCCTCGGCTGATGGCAACGGCCGGCTCTTTGAGCCGGCTCCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCGGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAAGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAGATGTTGACCGGCCATGGGTGTTTTGGCCGGTACCTCTTTAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATATCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCAGACAATTAAGCATTTAATGGACAACCAAATTGGACTACAAGAAGACTCAGAAGAAGAGTGCTTCAAGATCTACTAG
Protein
MALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFAKLGPRLMATAGSLSRLLPNVGSPDQVARRLYMGVVRSMALYGAPVWCHALTRKNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLFKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPLRVPPAPRGRIPPCGRAIGRTLPHRFWGGKHCHEEGGDSTGRVRDRVPTVRLERCESLISLYSARSSARGDASSGRETPALFADCVRQRTRRKRKSARRPASSAPSDSSEGEPASAKYMAMAEGPAAAAAPPATNCDISSRGLDAASSAQSRAACRKAKNGTEVGEVERLERSLTEVGPYDPLRRLNIIQKLVSAVATKSSAGLKGDYLRALKSSAASMEEILVEVVERTTDKENADLRRELDLMHARFAQVSEENGHLRAENGQIKVDMAELRTVVNDLLEKQRSSAPVPPPPEVEDESEAEELRRQLLISEARSSKVERARPPLAHEAKGAAPTPAPRKKMAAKTYGGPKKDATPAARSAASAAAPAKPGSSAKDTGAPKPAPSRAPITGQPKTQKAAPAPSQPAKVGPGRSRNKKKGGVNAAKPAPTPQPRPLPPAPANMDEAWTTVVRRGPKKVAAPPAPRPKPAPAATAPRQEGRAEPRGRNGRRRPRAPRSAAVLVELLPAGKEKGITYHEVMTQARGGVNVDALGVEGGIKVRQTANGARLIECPGPNTNAAAEKLAARLREILPDPEVVRIARPVKMGEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRVTYSGTRTAWARCPIATATLLATPPQGRPSDSPGRLRVGWVVAHVQLQDARPWRCLRCFGTGHGLAKCPSTVDRSGLCFRCGQPGHKAASCTTAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKKKPAAKRAAGESAPAAAPVQPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWMGDVDGSVAIVLRQSAALPPLEMVARGPGYVAARIDGTVVIGAYFSPNRSLAEFERFLGGLEALLHRLGSRPVIVAGDVNAKCTAWGSPRTDARGEALSEWAIATGLCLLNRGTVATCVRWNGQSHVDVTFASPSAVRRTRGWRVLEGAETLSDHRYVRFELSASSLSSSSAAGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHCRRRRRDATFAETAARLHADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQTRQLREIVAALFPPAAGGDFEPPQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSRMRAKDAAPGHDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNISYDWVLRGVIRGPLPGLSGDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPVGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGERRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLFKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYAQTIKHLMDNQIGLQEDSEEECFKIY

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=3.6852e-10,     Score=163

Ontologies

Topology

Length:
2343
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.753659999999996
Exp number, first 60 AAs:
0.46617
Total prob of N-in:
0.02597
outside
1  -  2343
 
 

Population Genetic Test Statistics

Pi
28.104574
Theta
18.049588
Tajima's D
0.384666
CLR
2.529529
CSRT
0.490925453727314
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号