SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01544
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.702 PlasmaMembrane   Reliability : 1.291
 

Sequence

CDS
ATGACAGTACGAAAAAGAAATAGGGTTTTATCGGCGACTCCCCATTCCACATTTAACGTGGATTTCAGCAATGTTAGGGGCCTACATAGTAACCTTGACGCCGTACACCACCACCTTGAGACGGCGCAGCCTGCCCTCCTTTTTCTAACGGAGACGCAGATATCAGCTCCGGATGATACCTCATATCTTGAGTACCCCGGCTACGTATTGGAGCACAACTTCCTGCGTAAAGCCGGGGTGTGTGTATTCGTCCGGGCTGATGTCTGTTGTCGCCGTCTTCGTGGCCTCGAACAACGGGACCTATCCCTCTTGTGGCTGCGCGTAGATCACGGGGGTTGTACCCGAATCTATGCGTGCCTGTACAGGTCCCACAGCAGTGATGCAGATTCAGCTCTGATAGAGCATGTGCAAGAGGGGACTAACCGCGTGCTTGAGCAGTACCCTTCTGCGGAGGTGGTGGTTCTTGGAGACTTTAACGCTCACCACCAAGAGTGGTTGGGGTCCAGAACCACTGACCTCCCGGGTCGGGCTGCCTACGATTTCGCCTTGTCCTACGGCCTCACTCAGCTGGTGACACAGCCCACCCGTGTCCCAGATATTGAGGGGCACGAGCCCTCTCTGTTGGACCTTCTGCTGACCACCGATCCGGCCGGATACAGTGTGGTGGTTGACGCTCCACTTGGATCGTCTGATCACTGCCTTATCCGAGCTGTGATACCAATCTCTCGTCCTGGTCGTCGAACGACGACCGGGTATCGAAGAATTTGGCGGTATATGTCAGCAGATTGGGATGGATTGCGTGAATTTTACTCTGCTTTTCCTCTGGTGATCCTGACGTCTGTGCGGACCGACTTAAAAACGTGGTGCTTCGGGGGATGGAATTGTAACTTCTGCAGGTCTAGTCTCCCACCACTACGCAAGTCCGATGACTGTCTGGCCCATAGTGCGAAAGAGAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACCGTGGACGACGGGGGTGCTACACCACCGAACATCCCCCGGTGTAATAGCTCCCTGCCTGAGATCTGCTTCACGCAGTGTGCAGTCAGGCAGGAGCTCCGACTGCTGGACGTCCATAAGTCGAGTGGGCCAGACGGCATCCCTGCAGTGGTTCTGAAAACGTGTGCCCCTGAGTTGACGCCTGCGCTAACGCGTTTGTATCGCCTCTCTTATTGCACTAACAGGGTTCCGTCTTCATGGAAGACTGCTCACGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTATAGGCCTATCGCGATAAATTCCTTGCTTTCCAAGGTGATGGAGCGAATAATTAATATACAACTCCTGAAGTATCTGGAGGATCGCCAGCTGATCAGTGACCGACAGTACGCTTTCCGTCACGGTCGCTCGGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGCGCTGAAGCCTTGGAGAGCAAGGGCGAGGCTCTTGTTGTGAGCCTTGATATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTATCGAAGTTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGCTCTGATACCATGACCATTAACGCTGGTGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTACTATGAGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTCAAGTGGAGAACTCTCTGGGGCGAGTCTCCGAATCCGAGACTCCGAACCCGTCAAAGACGCAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAAACTTCCGGGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAATTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGACTTTTGCTCTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAAGAGAGCCGTTCGGATTGTCGATAATCCCATTCTCACGGATCGTTTGGAGCCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGCATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCAACGTCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGATCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTGTTTCCCGAGCGCTATGACATGTCCTCCTTCAAACGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCTTGGCATTGCTGAAGTCCATGGGCGACGGTAA
Protein
MTVRKRNRVLSATPHSTFNVDFSNVRGLHSNLDAVHHHLETAQPALLFLTETQISAPDDTSYLEYPGYVLEHNFLRKAGVCVFVRADVCCRRLRGLEQRDLSLLWLRVDHGGCTRIYACLYRSHSSDADSALIEHVQEGTNRVLEQYPSAEVVVLGDFNAHHQEWLGSRTTDLPGRAAYDFALSYGLTQLVTQPTRVPDIEGHEPSLLDLLLTTDPAGYSVVVDAPLGSSDHCLIRAVIPISRPGRRTTTGYRRIWRYMSADWDGLREFYSAFPLVILTSVRTDLKTWCFGGWNCNFCRSSLPPLRKSDDCLAHSAKEKADLLVKLFASNSTVDDGGATPPNIPRCNSSLPEICFTQCAVRQELRLLDVHKSSGPDGIPAVVLKTCAPELTPALTRLYRLSYCTNRVPSSWKTAHVHPIPKKGDRSDPSSYRPIAINSLLSKVMERIINIQLLKYLEDRQLISDRQYAFRHGRSAGDLLVYLTHRCAEALESKGEALVVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHYYEDDSTGDARYIGHQSLSRSVVQERRSKLVSQVENSLGRVSESETPNPSKTQVCAFTAKKDPFVMAPQFQGVSLQTSGSIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQKRAVRIVDNPILTDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPTSRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSSFKRGLWRVLSGRQRLGSALGIAEVHGRR

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=1.81349e-05,     Score=119

Ontologies

GO

Topology

Length:
876
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01616
Exp number, first 60 AAs:
0.00022
Total prob of N-in:
0.00080
outside
1  -  876
 
 

Population Genetic Test Statistics

Pi
116.806943
Theta
42.77309
Tajima's D
0.491665
CLR
0.155997
CSRT
0.513824308784561
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号