SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01493
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.429
 

Sequence

CDS
ATGCAGCTCGGTCGCCCCCTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACCGTCGAATCCATAAATATCTTCACTGATCACGTCTCGACGGCGATCACAAGATCTTCAAAGCAAGTTGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTTAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTGAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAAAAGAACTCGCGCCCACTCACCAAGCATACTGGCGACTAGCTAGGACCCTCAAGTCCGAAACTATCGTCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTGCAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCAATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTTAGTTTGTATATCAACGATATACCCTGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCCTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCGGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCCGACTAG
Protein
MQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAITRSSKQVDVEDCFHRIRLSPDLRDLVRVRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLKELAPTHQAYWRLARTLKSETIVTMPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFQYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPWSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPD

Summary

EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ973342    KXZ75569.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    KQ973412    EFA12510.2    GGMS01006359    MBY75562.1    GGMR01019198    MBY31817.1    GGMS01002955    MBY72158.1    S59870    AAB26437.2    GGMS01000625    MBY69828.1    GFXV01007093    MBW18898.1    KQ973363    EFA13335.2    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    L79944    AAB04627.1    GALX01005299    JAB63167.1    ABLF02029306    ABLF02029314    ABLF02060138    NEVH01006736    PNF36716.1    ABLF02033757    GECU01013097    JAS94609.1    RPOV01000134    RPJ78669.1    ABLF02016634    GBBI01004571    JAC14141.1    GALX01005359    JAB63107.1    ABLF02040174    ABLF02040183    ABLF02055266    GFTR01008038    JAW08388.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMR01013409    MBY26028.1    ABLF02024246    GGMR01003407    MBY16026.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01007443    PNF35684.1    NEVH01003017    PNF40781.1    GBYB01008290    JAG78057.1    ABLF02021177    ABLF02027367    ABLF02066338    NEVH01020071    PNF21969.1    NEVH01005938    PNF38077.1    GGMR01000005    MBY12624.1    NEVH01023962    PNF17612.1    NEVH01019964    PNF22161.1    NEVH01019080    PNF22876.1    NEVH01010546    PNF32261.1    ABLF02034467    NEVH01023961    PNF17613.1    NEVH01007838    PNF34986.1    GGMR01012305    MBY24924.1    NEVH01000280    PNF43672.1    NEVH01001355    PNF42855.1    NEVH01005277    PNF39135.1    NEVH01014858    PNF27387.1    NEVH01006754    PNF36554.1    GGMS01002992    MBY72195.1    NEVH01002716    PNF41415.1    GGMS01008766    MBY77969.1    GGMR01014053    MBY26672.1    NEVH01011985    PNF31054.1    GGMS01017365    MBY86568.1    GGMR01006408    MBY19027.1    GAHY01000238    JAA77272.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    GBBI01001699    JAC17013.1    GGMS01000737    MBY69940.1    ABLF02024191    ABLF02066493    ABLF02028535    ABLF02028545    ABLF02042518    ABLF02057746    GGFL01004957    MBW69135.1    NEVH01006721    PNF37225.1    NEVH01017559    PNF23833.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    GGMR01000086    MBY12705.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF10551   MULE
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0106189,     Score=92

Ontologies

Topology

Length:
513
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.817979999999998
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00982
outside
1  -  513
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
96.489045
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号