SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01475
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.69
 

Sequence

CDS
ATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCTCTGCACGTTGTTCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTTGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACGAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACTTTTGAAGTAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTACGTTCCATCGAAGCACTGTCAGAGCTCGACTCAGACCACCGACCTGTCCTTATGCAGCTCGGTCGCCCTCACAACCCAGCCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGAAGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCTATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCTCCGAACTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCCTAAGTGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCCCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCATCCCACTCCCTAATAGGCGCGCAAACACCTCCGCCGTTAGCCCCGTCACTCTCTTTGGCCAGCCCATACCGTGGGCCTCGCAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATTAAAACGGTACGCGACCGTGCCGCCTTCATATTAGGACGTCTCTACCCTATGCTTTGCAAGCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGCATACGCCCCGTTATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAGCCCCTTCAGGTTATTCAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCTGAGGAACGTGGATCTCCACGATGACCTGGAGCTTGACTCTGTCAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGTAAACCGTCGACGTCGCCCAAAGCACGTCATTACGGATCCTCCTGATCCATTAACGGTGCTCTTAGGCACCACAAGCACCGGTCACCGTCCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGCGAACTAA
Protein
MVRNDRLTASKGGTAIYYRRALHVVPLDTPSLLHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEVVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEALSELDSDHRPVLMQLGRPHNPATVTRTMVDWNKLGTCLAEAAPPILPYGPDSNLSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSSELRNLLRVRNAAIRAYDRLPTHSNRIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIRNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLPTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSIPLPNRRANTSAVSPVTLFGQPIPWASQVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCKRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSVSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMVNRRRRPKHVITDPPDPLTVLLGTTSTGHRPRRTRRLRRRARRAN

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    GBBI01004571    JAC14141.1    ABLF02042518    ABLF02057746    GGMS01002992    MBY72195.1    GFTR01008038    JAW08388.1    S59870    AAB26437.2    RPOV01000134    RPJ78669.1    GFTR01008279    JAW08147.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    KQ973412    EFA12510.2    ABLF02024246    GGMS01006359    MBY75562.1    NEVH01006736    PNF36716.1    GGMR01003407    MBY16026.1    ABLF02008153    ABLF02008462    ABLF02008464    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    KK119692    KFM76444.1    NEVH01026386    PNF14434.1    GEZM01053022    JAV74219.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02034467    GFTR01008262    JAW08164.1    GGFL01005012    MBW69190.1    NEVH01011985    PNF31054.1    GGFL01004957    MBW69135.1    GFTR01008261    JAW08165.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    GFTR01008271    JAW08155.1    GGMR01000676    MBY13295.1    NEVH01021205    PNF19912.1    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    GFXV01000908    MBW12713.1    GBGD01000415    JAC88474.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GGFJ01001858    MBW50999.1    NEVH01020940    PNF20481.1    ABLF02022418    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGFJ01001857    MBW50998.1    GGMS01017365    MBY86568.1    GFTR01008256    JAW08170.1    GFTR01008251    JAW08175.1    GBHO01008295    JAG35309.1    NEVH01022639    PNF18527.1    NEVH01017470    PNF24199.1    NEVH01016302    PNF25823.1    GGMR01012305    MBY24924.1    GFTR01008269    JAW08157.1    M22874    M38643    GEDC01000337    JAS36961.1    GEZM01084969    JAV60363.1    M38437    ABLF02023911    JRES01000644    KNC29657.1    GGMR01016905    MBY29524.1    GFTR01008257    JAW08169.1    GFTR01008151    JAW08275.1    NWSH01007753    PCG62823.1    GGMR01006408    MBY19027.1    LBMM01013518    KMQ85605.1    ABLF02028535    ABLF02028545    KU543673    AMS38352.1    GBGD01000389    JAC88500.1    KQ973363    EFA13335.2    KK119261    KFM75202.1    DNOY01000259    HBE18313.1    GGMR01013409    MBY26028.1    GFTR01008254    JAW08172.1    GGMR01000226    MBY12845.1    AY060438    AAL25477.1    GGMR01006491    MBY19110.1    NEVH01006721    PNF37225.1    NWSH01000032    PCG80496.1    GFXV01002840    MBW14645.1    GGMS01000737    MBY69940.1    NEVH01019963    PNF22185.1    GFTR01008246    JAW08180.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.00140776,     Score=102

Ontologies

Topology

Length:
899
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.05225
Exp number, first 60 AAs:
0.02127
Total prob of N-in:
0.02040
outside
1  -  899
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
17.042811
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号