SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01460
Annotation
PREDICTED:_uncharacterized_protein_LOC101747137_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 3.325
 

Sequence

CDS
ATGCACACGTTCACCGATGCTAGCGAGAAGGCCTACGCGTGTGCAGTCTATTGGCGTCAGAAGACAGACGAGAGCACCTACCGCGTCACGCTTCTAGCAGGGAAAGCCAGGGTGACCCCACTGAGACCAGTCTCTATCCCAAGGCTGGAGCTGCAAGCTGCACTGCTGGGGACAAGGATGGCGCAGGCGATAGCGAACGAATTGGACATCGCGGTCGGCAGAAGGACGTACTGGACTGACTCCAGTACAGTTCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCGTTGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAAAACCCAGCAGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGACGTGGGATGAATCGCGCTGGCCCAAGCCACGAACATTCAAGCAAGAACCGTCTGGAGAGGAGAAAGAGGCCTTCCTGGTCGCCACGGCGAGGACCGCTGACGCTCGATCCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAAGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATTGAGCTGTGTCGACCCCGGAAGGAGAGCGCCTGCGTGTCCAGACAATTGAAGCAGCAAGATCCCACGTGGAGGAGGACACCAACGAAGCAACCCCGATCCACATGGAAGTTAAGGACCCCGGAAGCACCTACAGAAGCATGGCTGCCGCTTGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATCGACGCAGCGCAATACATAGATGCAGGCTGCAAGCGACCGATCGTGCTGGACGGGAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGGGAAGAACACCGCTGTAGCACTGCAACTGAGCATTCGCCTAATAAGATCTGATCGTCTTAAAGAGGTATCATGA
Protein
MHTFTDASEKAYACAVYWRQKTDESTYRVTLLAGKARVTPLRPVSIPRLELQAALLGTRMAQAIANELDIAVGRRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLTWDESRWPKPRTFKQEPSGEEKEAFLVATARTADARSTPDPHRFSSWVKLLRATARVLQFIELCRPRKESACVSRQLKQQDPTWRRTPTKQPRSTWKLRTPEAPTEAWLPLDPPHLKKAEKILLRSSQGESFGEKDPERHPKLRRLDVVMEDGLLRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHGKNTAVALQLSIRLIRSDRLKEVS

Summary

EMBL
AF530470    AAQ09229.1    AB042119    BAA95570.1    AB042118    BAA95569.1    + More
NWSH01008670    PCG62455.1    KQ459986    KPJ18861.1    AAZX01023278    LNIX01000039    OXA39294.1    LNIX01000003    OXA57597.1    LNIX01000019    OXA44812.1    OXA44855.1    LNIX01000015    OXA46575.1    JTDY01001530    KOB73634.1    LNIX01000004    OXA56382.1    JXUM01127084    KQ567147    KXJ69602.1    GAMC01017930    JAB88625.1    LNIX01000007    OXA52015.1    JXUM01013493    KQ560378    KXJ82704.1    GEHC01000914    JAV46731.1    JXUM01109099    KQ565290    KXJ71123.1    GEHC01000967    JAV46678.1    GEHC01000913    JAV46732.1    GEHC01000947    JAV46698.1    JXUM01005879    KQ560203    KXJ83865.1    GGFJ01001462    MBW50603.1    GGFJ01001476    MBW50617.1    GAMC01020594    JAB85961.1    GAMC01020598    GAMC01020596    GAMC01020592    JAB85959.1    GGFJ01000218    MBW49359.1    GGFL01005193    MBW69371.1    GGFJ01000302    MBW49443.1    OXA55408.1    GEHC01000872    JAV46773.1    APCN01002024    JXUM01111221    KQ565482    KXJ70922.1    GCES01140631    JAQ45691.1    LNIX01000018    OXA45362.1    JXUM01136032    KQ568367    KXJ69026.1    GEZM01052587    JAV74399.1    GCES01132273    JAQ54049.1    GCES01111900    JAQ74422.1    GCES01134385    JAQ51937.1    GGFL01001842    MBW66020.1    GGFL01001682    MBW65860.1    JXUM01016534    JXUM01056823    KQ561926    KQ560461    KXJ77135.1    KXJ82302.1    GEZM01052586    JAV74401.1    AB110069    BAD01590.1    BAD01589.1    ODYU01003174    SOQ41584.1    LSMT01000075    PFX28896.1    GGFJ01000432    MBW49573.1    GGFJ01000487    MBW49628.1    MRZV01000348    PIK51982.1    GCES01110894    JAQ75428.1    DNYX01000180    HBK83090.1    LN877231    CTR11689.1    JXUM01083542    KQ563383    KXJ73941.1    AAGJ04142769    AAGJ04142770    JXUM01008943    KQ560272    KXJ83402.1    LNIX01000012    OXA48117.1    GBYX01459357    JAO22202.1    AAGJ04043389    GCES01097275    JAQ89047.1    GEHC01000945    JAV46700.1    AAGJ04125735    GDIQ01114015    JAL37711.1    GGMR01020500    MBY33119.1    GAMC01020600    JAB85955.1    GBYX01459355    JAO22204.1    LSMT01000392    PFX18796.1    JXUM01038372    KQ561162    KXJ79503.1    GCES01137317    JAQ49005.1    KL367687    KFD60188.1    JXUM01009840    KQ560293    KXJ83223.1    GCES01103975    JAQ82347.1    LSMT01000699    PFX15001.1    KL367865    KFD59509.1    GDIP01036233    JAM67482.1    GDIP01004568    JAM99147.1    AAGJ04008210    JYDH01000309    KRY26933.1    KRY26929.1    AAGJ04001285    AAGJ04091218    JXUM01130316    KQ567562    KXJ69370.1    LSMT01000016    PFX33015.1    GCES01148879    JAQ37443.1   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00628   PHD
PF00078   RVT_1
PF13516   LRR_6
PF18738   HEPN_DZIP3
PF05729   NACHT
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR036875   Znf_CCHC_sf       
IPR019786   Zinc_finger_PHD-type_CS       
IPR000253   FHA_dom       
IPR000477   RT_dom       
IPR001841   Znf_RING       
IPR001969   Aspartic_peptidase_AS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR002999   Tudor       
IPR032675   LRR_dom_sf       
IPR027417   P-loop_NTPase       
IPR007111   NACHT_NTPase       
IPR001611   Leu-rich_rpt       
IPR041249   HEPN_DZIP3       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF57756   SSF57756       
SSF52540   SSF52540       

Ontologies

Topology

Length:
370
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00107
Exp number, first 60 AAs:
0.00063
Total prob of N-in:
0.02014
outside
1  -  370
 
 

Population Genetic Test Statistics

Pi
352.834048
Theta
183.814424
Tajima's D
2.886118
CLR
0.102794
CSRT
0.975001249937503
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号