SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01437  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA008952
Annotation
target_of_rapamycin_isoform_1_[Bombyx_mori]
Full name
Serine/threonine-protein kinase TOR      
Location in the cell
Nuclear   Reliability : 2.644
 

Sequence

CDS
ATGACGAATCATCAAGTATTAGAGCTGATATCAGGTCTAAAATCTCGACATTCAGAAACAAGACACCGAGCTGTGCGAGAGTTGCTACATTTTGCCAAAACAGAACTGCGGGAAATGTCTCAGGATAGTTTGACCCAAATTTTAGATGATTTCAACCAACAGATACACGATATGACCACTAGTTACGATAACAACGAAAAAAAAGCTGGAATTCTTACTATAGTTTGTCTTATTGGAGGTGATACAGAGACCACCAAAACAAGGACAATACGTTATGCAAATTATCTACGAAATGTGTTTCCATCTACAGACATAAATCTCTTAGAATTGGGTGCTAAAACTATGGGACGATTAGCTTCCTCATTAGGAATTAAAAGAGGAGAATATGTGGAGACTGAAATAAAAAGATGTTTCGAATGGCTAGCTGAAGAAAGAAATGAAGGCAAACGATTATCGGCTGTTTTAATTTTGAGAGAACTGGCTATATCTATGCCATCATATTTTTTTCAGCAAATAAATGGATTCTTCAATCATATCATGAGAGCACTTAGAGATCCTAAAGATCAAATACGAGAAGCTGCAGCAAAAGTTTTGAGGGCTGCTTTTGCAGTAACCTCTCAGAGAGAGCAGCCAGAGCAAAGTAACAAAGCTCATTGGTATATTCAATGTTATGAAGAAGCAGAGACATCATTTGGTGATCATGCTATTAGAGAAAGGGGATTGAACAGGGATGACCATGTGCATGGAGCTTTATTAATTCTAAATGAATTACTCAGGTGCTCAAATGCAGCATGGGAGAAAAAATACACTTCTCTAATGCAAAAGCTAGACCCTGATTTAGATTCTCATGATGAAATGTCTTCTCTCAGTCCTAAAATTCAGGGTTCATGGTCATTGTCACATTATTCAGATGAAAAAAATCAACCTCTAATATTTGAATCCAGTATTTGCAAGAAATTAATTGAAGATAATTGTGAAAAAATCTCAGCTGATGTAATGGCTCAGCAAATATCAAGAGCTCATAATGTGCATCAGATGCTCCTTCTGTTAATACCTCGATTAGCTGCCTTCAACAAAGAAACTTTTGCTAAAAGACATCTGAAGTCAACGATAAATCATTTGATAACATTCTTACGTGGTAGAGAAAAAGAAAAGGCCATGGCTTTCACCACACTTGGCTTGGTTTGTGTAGCTATGGAATCAGATGTACAACAGTATCTCTCAAGAATTATTGATATTATCAAATTAACCCTGCCAATCAAAGAAACACAGAAAAAACGTAACGGATCTGAAACACCATTATTTCATTGTGTTACATTACTAGGATTTGCCATGAAAGAGAATGTAGCAAATGAAGTTAGAGAGCTGCTAGATTCTATGTGTTTGACAGGCTTAAGTCCACAATTAACAACTTGCTTTAAAGAACTAAGCAATAATTTACCTTCTTTAAAAAAAGATATAACTGATAAATTATTGAACATGCTATCTTTAATATTGAGAAAGAAACCTTATGTTTCTACCAACGAAAATCACAAAGGTGTCTTCACAACTGCTTTGCTAGCAGAACCTCATGATGCCAATAAATTAGTATTGGCTTTGAGGACTCTAGGTTCTTTTGATTTTGAATGGAATAACACTTTGATGTCCTTCATCAGAAGGTGTACAGATCATTATCTGCTGTGTGATCATCACGACATTCGGCTAGAAGCAGTAAAGACAGCTGCAAGATTATTAACGAAAGCTGTGGAGAGATGCGCCCAGATAAATTCACGAACTTTAAATTTAATGATTGATGAATCCATAGGTAAAATTTTGTCTGTTGGACGATCAGATTTTGATCATGAAATACGCTACAGAGTACTTGAGGTGTTTATGAATCCAGTATTTGACAGATATCTTGCTGTAGAAGAACATCTAAATTGTCTTTTTGTTTCTATTAATGACTCGAATTCTGAAGTTGGAGAACTAGCACTGTGCATTTTTGCAAGATTGAGCAATCTCAACCCAAGCTATACCACACCAACATTGCGTCAACTGTATGTACAAATTCTAATAGATTTGCAACATTCAGAATCTCCGCGGAATAAAGAAAAAGCTTTACGAATGATAAATAATATTATATCTCATGCTCCCACAATTACACGTCAATTTGTTGATACAATTCTAAATGTGCTTATACCGAAACTGAAAGAAAAGGACAGTAATTCCACTATGATATCTACAGTACTAAAGGCCATCGGAGATTTGGCAGAGGTTAATGGTGGTGGACATGCTTTAAATAAATGGTTAACAGAATTGATTTCTACTCAAATTGAAATCCTGGCAGATCCTAATCAAATCGAAAAGAGAAGTGTTGCCCTATGGTCTTTTGGTCAAGTTGTAAGTGCAACAGGGCACGTGGTCGCTCCATACATGGAATATCCCAAGCTAATGGATCTTTTGCTAAATTTCTTAAAAACGGAACAGCAACTTCGAGAAATACGCGAAACTGTTCGGATTTTGGGATTGTTAGGAGCATTAGATCCATATAAATATAAAGTAAATCAAGGATTAATAGATTTCCAAACTGTGTCTACTTTGATACCTATAAGGGAGCCGTCAGTCGATAGTTTTGAATCTAATATCAGTGAAATGTTAGTAAATATGTCACCGTTAGTACTAGATGAATTTTATCCAGCCATCGTAGTGACTTCACTAATGATAATGTTGCGCGATCCGACGTTAGCGCACCACCATCCAAGTGTTGTGCATTCTGTAACTTTTATCTTCCAATCACTGGGTATTAAATGCGTCCCGTACATATCACGTGTGACGCCAACGCTTCTACACGTTATTCGGACAACGGAAAACAGCAATTTTCGTGAAATACTTTTGACGCAATTAGCACAATTGATATCTGTTGTGAAAATCCACATTCGAAACTATCTGGAAGACATTTTTGACATGATAAGGGAGTACTGGACTCCCAACAGCCACCTCCAAGCTACCCTAATAATGTTGGTCGAACACATAACGGTCGCGATCGGTACAGAATTTAAAATTTACTTACGTAAAATACTACCGAACATTCTTAGGGTATTGAAACACGACACAAGCAAGGATAGATTTTTGACAGAGAAACTGTTAATAACAATACAAAAGTTTGAGAATAATTTGGATGACGTGCTCTTGTCGGTGGTGCCAGCGATAACCGCCCTGTTTGACGGGAGAAACATTCCGTTCGCAATTTCGAAGCTTGCGATGGAGACCATCGAGCATCTCTCCGTGCACTTGTGCGTCAAACAGTATTCGGCGACAATCATTCAAGCCCTCGTCAAAGTTTTGGATAACAACGCTTCATTGAGGCAAACTGCAATGAACACTCTCTCCGCTTTGATAGTTCAAATGGGCCGCGAATACATAGATTACATACCGTCTATGGAAAGGATATTATCGAAACATAAAATACAATGTCCTAACTATATCGTGTTGGTAACGCGGTTACAGCTAATATCTACGCTTGCATCAGATGATGATTATTTGGACGAAACGCGGTCAAGACTTCGTAATCAAAAGAACGAAATGGTAAGGTGCACAACGGAAATGCAGCCTATACAGAAAGTTACGTTAAATGTACACAATTTACGTAAATGTTGGTCTGTCCATAACATTGTGTCCAAAGAAGACTGGATGGAGTGGTTGCGTCTGCTCAGTGTCGGCTTCCTGACCGAATCCAACAGCCCTGCTATCAGAGCCTGTTCTACTTTAGCACACAACAACCCTCAACTTGCGAGCGATCTGTTCAATGCGGCGTTCATGTCGTGCTGGACGGAGCTGGACGAGTCCTCGCGCAAGGACTTGGTGGCGGCCTTGGAGCGAGCACTCACCGTGCCCGACCTGCCGGAATTAGCGTTAGCGGTCCTCAACCTGGCCGAGTTTATGGAGCATTGTGAAAAATCATTGTTACCGATTTCCATAAAGTTACTCGGAGACACAGCTATAAGCTGTAGGGCTTACGCTAAAGCTCTTTATTATAAGGAGGAAGAGTATAAGAAAAATCCGTGTACGAAGGTAATTGAAGCTTTAATTCATATAAACAATAAGTTGCAACGTAAAGAAGCTACTAACGGCTTACTCGAAAAAGCAGTTAGTGAAAACAAAAACGGAGAGAATGCTATAAATAACCACGTTCACTGGTACGAAAAACTTAACAATTGGGACCAAGCTCTAGAACTGTATACTATTGCATTAGAATCTCAGCCCAACGACGAGGCTTCAAAGTTGGGAACGATGCGGTGTCTGGAAGCTATGGGCGAATGGAAAAGATTGTACAGTATGACCCACGATCAATGGGACAACATGGACGAGGAGTTTCGTAATAAATCTGCGAAAATGGCCGCAGCGGCATCTTGGGGTCTTCAAGAATGGTACTCGATGAAGAAATACGTGGAACTGATTCCAGAAAGTACCCAAGACGGGGCTTTTTACAGGGCCATCATAAACATACAGGACGGACAGTGGGCCGAATCGAGACATTACATCGATCTTGCCAGAAGTCTCATAGATGTCGAGCTGACAGCAGTGGTTGGAGAAAGTTATCAAAGGGCTTATGGAACACTAGTCAACGCCCAACTGCTAACCGAATTAGAAGAAATTATCACTTATAAATTAATAGAAGAAAGACGAAGCACAATCCGAAAGACTTGGTGGACACGACTCCAAGGCGGGCAGAGGCTGGTCGAGGATTGGAGGAAGATATTACAAGTGCGCAGTCTAGTCATGTCGCCGAGAGAAGATTTTCAGACGTGGTTGAAATTTGCGTCGCTATGCAGGAAAACGGGCGCAATTAATCAAGCGCATAAGATAGTTATTTCGGTGTTGGGCAGCGATCCGATCTCGAACCCCGACGTCATGTTACACGTGCAGGACCCGCGAATCGTTCTGGCTTACAGCAAGAACTTATGGGATGTCGGCAACAAACGTTACGCTCACGATGTCTTGCAAAGATTCGTGGATAGCACCGAACCGGAAAACGAAGAACATTGTCGTCTCTTAGCGCGTTGTCACTTGAAATTGGGCTCGTGGTGCGAAGCAATACACGAAATCAATGAGCTATCGATCCCGGAAATCTTAAGGAACTACGCGACCGCAACGATCCTCGCCCCGGAATGGTACAAAGCGTGTCACGCGTGGGCGTGTATGAACTTCGAAACGGTTCTGTTTTACAAGCAACAAGACAACACGTCGGAGAGCAGTGTAACGGGCGGTACTGGCGAGAAAAAAGTCGCTCGAACCGACTTCATAAACGCGTACACGATACCCGCTATCGAAGGTTTCTTCAAGTCTATAAGTTTGTCGAACGGCAACGCTTTGCAAGACACGTTGAGATTGTTGACTCTGTGGTTCGACCACGGACATCATCCGGCCATTTACGATGCAATATTCGAAGGGATACGACAGATCGACATCAAGATATGGCTACAGGTCATACCACAGCTGATAGCCAGGATCGATTCGCCGCGAAGTCTCGTAGCTAAACTGGTTCACATCCTTTTGATTGATATCGGAAAATCTCACCCTCAAGCCCTGGTTTATCCATTGACGGTCGCGACGAAGTCATCGTTCGTGACCAGGAAAAACGCCGCCAACTACGTATTGAAAACTATGTGCATTCATGCACAGAATCTGGTGAACGAAGCCGCTATTATTTCGGAAGAGTTGATCAAAGTGGCAATACTGTGGCACGATCAAGTTTACATAGCACTCGATGAAGCGTCAAGGTTTTGTTTCAGCGAGAAAGATTATAAGAGAATGTTTAAAACTTTGGACAAAATGCACGCAATGCTGGATACCCCTCCGGAGACGTTGAAGGAAGTCTCATTCCTGCAGATGTATGGACGCGATCTACAGGAGGCGCGGCGCTGGTGCGAGTTATACAAGGAGAGCAACGAAGAGAGGTACCTGAACGAAGCGTGGGATCTGTACTACCACGTGGTGCGGCGCATCCAAGCCCAGTTCCGGTCGCTGACGTCACTGGAGCTGCAGTACGTCAGCAAACGTTTGCATTCGTGCAAGGACCTGGAGCTGGCCGTCCCGGGCTCGTACGTGCCTAATCAGAAAATAATTAACATCTCGTACATACACAGCAATTTGCAGGTAATCAAGTCGAAGCAGCGTCCGAGACGTCTGACCATACAGGGCTCTGACGGCAAACAGTACATGTTCCTGCTGAAGGGCCACGAGGACCTGCGGCAGGACGAGCGCGTGATGCAGCTCTTCGGATTGGTCAACGCTCTGCTGCGGGCCGACGCCGACACGTACCGACACGACCTCGCCATACAGAGATACGCGGTCATACCGCTCTCCCCCAACTCCGGACTCATCGGCTGGGTCCCGCACTGCGACACTCTCTACAATCTAATCAGCGAATTTCGCGATAAAAAGACGAACAAAACGGCGCTGAACACGGAACAGCAGATCATGTTGAGGATGGCCTCGGATTACCAGAAGTTGATGCTGAAGCATAAGGTGGAGGTTTTCGAATACGCGCTTTCGCAGACGCCGGGCAACGACCTGGCGCGGCTGCTGTGGCTGAAGAGTCCGTCGTCGGAGGTGTGGTTCGAGCGGCGCACCAACTACACGCGCTCGCTCGCCGTCATGAGCATGGTGGGCTACATCCTCGGCCTCGGAGACAGGCACCCGTCCAACATCATGCTGCACAAAGTCACCGGCAAGGTCCTGCACATTGACTTCGGCGACTGTTTCGAAGTCACGCAGACGAGGGAGAAGTTTCCCGAAAAGATACCCTTCAGACTGACCAGGATGCTCATCAATGCTATGGAGGTAACCGGCATCGAAGGTACGTACCGCTTCACCTGCGAATCTGTGATGCACGTCCTCCACAAACACAGAGACAGCGTAATGGCTGTGCTCGAAGCCTTCGTCTACGACCCGTTACTGAACTGGCGGCTTGTAGACAACGACCATCACTCCATCACGGAGTCCTCGTTCTCCTCAGACATAGACTATTCGTACACCCTCCCGAACAGAAGCCGAAATCATTTGCTTTACGAATCACCAGAGATCCCGCCCGAGGCTAATCTAAATAAACGCGCGGTCGCCATTTTGAACAGGATTAGGGACAAATTGACCGGAAGGGACTTTCCTAATGTTGAATCTATAGTGAGCGTGCCCCAACAAGTGGAACTGCTCGTGAAGCAGGCGACAAGCAATGAGAACCTCTGTCAGTGCTATATCGGCTGGTGTCCATTCTGGTAG
Protein
MTNHQVLELISGLKSRHSETRHRAVRELLHFAKTELREMSQDSLTQILDDFNQQIHDMTTSYDNNEKKAGILTIVCLIGGDTETTKTRTIRYANYLRNVFPSTDINLLELGAKTMGRLASSLGIKRGEYVETEIKRCFEWLAEERNEGKRLSAVLILRELAISMPSYFFQQINGFFNHIMRALRDPKDQIREAAAKVLRAAFAVTSQREQPEQSNKAHWYIQCYEEAETSFGDHAIRERGLNRDDHVHGALLILNELLRCSNAAWEKKYTSLMQKLDPDLDSHDEMSSLSPKIQGSWSLSHYSDEKNQPLIFESSICKKLIEDNCEKISADVMAQQISRAHNVHQMLLLLIPRLAAFNKETFAKRHLKSTINHLITFLRGREKEKAMAFTTLGLVCVAMESDVQQYLSRIIDIIKLTLPIKETQKKRNGSETPLFHCVTLLGFAMKENVANEVRELLDSMCLTGLSPQLTTCFKELSNNLPSLKKDITDKLLNMLSLILRKKPYVSTNENHKGVFTTALLAEPHDANKLVLALRTLGSFDFEWNNTLMSFIRRCTDHYLLCDHHDIRLEAVKTAARLLTKAVERCAQINSRTLNLMIDESIGKILSVGRSDFDHEIRYRVLEVFMNPVFDRYLAVEEHLNCLFVSINDSNSEVGELALCIFARLSNLNPSYTTPTLRQLYVQILIDLQHSESPRNKEKALRMINNIISHAPTITRQFVDTILNVLIPKLKEKDSNSTMISTVLKAIGDLAEVNGGGHALNKWLTELISTQIEILADPNQIEKRSVALWSFGQVVSATGHVVAPYMEYPKLMDLLLNFLKTEQQLREIRETVRILGLLGALDPYKYKVNQGLIDFQTVSTLIPIREPSVDSFESNISEMLVNMSPLVLDEFYPAIVVTSLMIMLRDPTLAHHHPSVVHSVTFIFQSLGIKCVPYISRVTPTLLHVIRTTENSNFREILLTQLAQLISVVKIHIRNYLEDIFDMIREYWTPNSHLQATLIMLVEHITVAIGTEFKIYLRKILPNILRVLKHDTSKDRFLTEKLLITIQKFENNLDDVLLSVVPAITALFDGRNIPFAISKLAMETIEHLSVHLCVKQYSATIIQALVKVLDNNASLRQTAMNTLSALIVQMGREYIDYIPSMERILSKHKIQCPNYIVLVTRLQLISTLASDDDYLDETRSRLRNQKNEMVRCTTEMQPIQKVTLNVHNLRKCWSVHNIVSKEDWMEWLRLLSVGFLTESNSPAIRACSTLAHNNPQLASDLFNAAFMSCWTELDESSRKDLVAALERALTVPDLPELALAVLNLAEFMEHCEKSLLPISIKLLGDTAISCRAYAKALYYKEEEYKKNPCTKVIEALIHINNKLQRKEATNGLLEKAVSENKNGENAINNHVHWYEKLNNWDQALELYTIALESQPNDEASKLGTMRCLEAMGEWKRLYSMTHDQWDNMDEEFRNKSAKMAAAASWGLQEWYSMKKYVELIPESTQDGAFYRAIINIQDGQWAESRHYIDLARSLIDVELTAVVGESYQRAYGTLVNAQLLTELEEIITYKLIEERRSTIRKTWWTRLQGGQRLVEDWRKILQVRSLVMSPREDFQTWLKFASLCRKTGAINQAHKIVISVLGSDPISNPDVMLHVQDPRIVLAYSKNLWDVGNKRYAHDVLQRFVDSTEPENEEHCRLLARCHLKLGSWCEAIHEINELSIPEILRNYATATILAPEWYKACHAWACMNFETVLFYKQQDNTSESSVTGGTGEKKVARTDFINAYTIPAIEGFFKSISLSNGNALQDTLRLLTLWFDHGHHPAIYDAIFEGIRQIDIKIWLQVIPQLIARIDSPRSLVAKLVHILLIDIGKSHPQALVYPLTVATKSSFVTRKNAANYVLKTMCIHAQNLVNEAAIISEELIKVAILWHDQVYIALDEASRFCFSEKDYKRMFKTLDKMHAMLDTPPETLKEVSFLQMYGRDLQEARRWCELYKESNEERYLNEAWDLYYHVVRRIQAQFRSLTSLELQYVSKRLHSCKDLELAVPGSYVPNQKIINISYIHSNLQVIKSKQRPRRLTIQGSDGKQYMFLLKGHEDLRQDERVMQLFGLVNALLRADADTYRHDLAIQRYAVIPLSPNSGLIGWVPHCDTLYNLISEFRDKKTNKTALNTEQQIMLRMASDYQKLMLKHKVEVFEYALSQTPGNDLARLLWLKSPSSEVWFERRTNYTRSLAVMSMVGYILGLGDRHPSNIMLHKVTGKVLHIDFGDCFEVTQTREKFPEKIPFRLTRMLINAMEVTGIEGTYRFTCESVMHVLHKHRDSVMAVLEAFVYDPLLNWRLVDNDHHSITESSFSSDIDYSYTLPNRSRNHLLYESPEIPPEANLNKRAVAILNRIRDKLTGRDFPNVESIVSVPQQVELLVKQATSNENLCQCYIGWCPFW

Summary

Catalytic Activity
ATP + L-seryl-[protein] = ADP + H(+) + O-phospho-L-seryl-[protein]
ATP + L-threonyl-[protein] = ADP + H(+) + O-phospho-L-threonyl-[protein]
Similarity
Belongs to the PI3/PI4-kinase family.
EC Number
2.7.11.1
EMBL
GU350772    ADB91963.1    ODYU01010861    SOQ56223.1    KZ149902    PZC78466.1    + More
NWSH01000622    PCG75224.1    PCG75225.1    AGBW02009978    OWR49429.1    BABH01012486    BABH01012487    KQ459989    KPJ18654.1    PCG75228.1    PCG75229.1    PZC78469.1    SOQ56225.1    KPJ18652.1    KQ459562    KPI99850.1    GU350773    ADB91964.1    OWR49427.1    JTDY01001304    KOB74250.1    KZ288215    PBC32626.1    KQ414735    KOC62255.1    NEVH01016943    PNF25178.1    KQ435127    KZC14833.1    GBYB01004754    JAG74521.1    GBYB01004751    JAG74518.1    EU926975    ACH47049.1    KK107119    EZA58683.1    GL443520    EFN61954.1    GEDC01021234    JAS16064.1    ADTU01027564    KQ978426    KYM94028.1    KQ981993    KYN31116.1    KQ976730    KYM76409.1    NNAY01001912    OXU22583.1    GL763054    EFZ20258.1    GEZM01054727    JAV73459.1    GL452770    EFN76766.1    UFQS01002589    UFQT01002589    SSX14318.1    SSX33729.1    UFQS01002850    UFQT01002850    SSX14750.1    SSX34142.1    KQ982974    KYQ48590.1    KQ971362    EFA07964.1    SSX14319.1    SSX33730.1    CH477199    EAT48240.1    DS235250    EEB13969.1    HQ875574    AEA11029.1    GFTR01008965    JAW07461.1    JQ793898    AFJ74724.1    AY438003    AAR97336.1    ACPB03017386    ACPB03017387    KP187832    AKB11618.1    DS231887    EDS43487.1    GGMS01003246    MBY72449.1    GDHC01020467    GDHC01011432    JAP98161.1    JAQ07197.1    JXUM01031780    JXUM01031781    KQ560935    KXJ80282.1    GFXV01008113    MBW19918.1    KR075825    ALE20544.1    QOIP01000009    RLU18582.1    CVRI01000063    CRL04799.1    ABLF02038863    AAAB01008964    EAA12914.4    AMQN01009177    KB304845    ELU01654.1    JRES01000681    KNC29211.1    APCN01002505    GAMC01017478    JAB89077.1    GBXI01012713    JAD01579.1    KA644695    AFP59324.1    FJ167395    ACN38706.1    JXJN01026847    JXJN01008153    GEFH01002011    JAP66570.1    GEDV01007348    JAP81209.1    GDIP01043629    JAM60086.1    GFPF01007816    MAA18962.1    GFAA01002322    JAU01113.1    GFAC01001415    JAT97773.1    GDIQ01180336    JAK71389.1    GDIQ01190585    JAK61140.1    GDIQ01244975    GDIQ01238972    GDIQ01066032    GDIQ01064631    GDIQ01030350    JAK12753.1    GDIQ01175139    JAK76586.1    GDIQ01126813    JAL24913.1    GDIQ01152003    JAK99722.1    GDIQ01209128    JAK42597.1    GACK01003463    JAA61571.1    GDIQ01125109    JAL26617.1    GDIQ01059285    JAN35452.1   
Pfam
PF02260   FATC        + More
PF08771   FRB_dom
PF02259   FAT
PF00454   PI3_PI4_kinase
PF11865   DUF3385
PF02985   HEAT
PF06424   PRP1_N
PF01459   Porin_3
Interpro
IPR003152   FATC_dom        + More
IPR009076   FRB_dom       
IPR014009   PIK_FAT       
IPR000403   PI3/4_kinase_cat_dom       
IPR018936   PI3/4_kinase_CS       
IPR011009   Kinase-like_dom_sf       
IPR026683   TOR       
IPR003151   PIK-rel_kinase_FAT       
IPR011989   ARM-like       
IPR016024   ARM-type_fold       
IPR013026   TPR-contain_dom       
IPR024585   DUF3385_TOR       
IPR019734   TPR_repeat       
IPR036738   FRB_sf       
IPR036940   PI3/4_kinase_cat_sf       
IPR011990   TPR-like_helical_dom_sf       
IPR000357   HEAT       
IPR003107   HAT       
IPR010491   PRP1_N       
IPR021133   HEAT_type_2       
IPR027246   Porin_Euk/Tom40       
IPR037930   Tom40       
IPR023614   Porin_dom_sf       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR000504   RRM_dom       
IPR035979   RBD_domain_sf       
SUPFAM
SSF47212   SSF47212        + More
SSF56112   SSF56112       
SSF48371   SSF48371       
SSF48452   SSF48452       
SSF54928   SSF54928       
PDB
5ZCS     E-value=0,     Score=5715

Ontologies

Topology

Length:
2418
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0887300000000002
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00305
outside
1  -  2418
 
 

Population Genetic Test Statistics

Pi
216.302492
Theta
161.530762
Tajima's D
0.555088
CLR
0.539123
CSRT
0.528023598820059
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号