SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01435  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA008924
Annotation
target_of_rapamycin_isoform_2_[Bombyx_mori]
Full name
Serine/threonine-protein kinase TOR      
Location in the cell
Nuclear   Reliability : 1.925
 

Sequence

CDS
ATGTCTAATCAAGTAGCTCAATTTGTTTCGGGACTGAAGTCTCGAACGGTTGACATTCAGATAAAGACTGCACGTGAACTTTATCATTATGCGAAGACGGAATTACGAGAGGTACCACAAGAGGAACTCACGCAGTTCCTCGATGAATTCAATCATCAAATATTTGAAATGGTTTCAAGCAATGACGTCCACGAAAAGAAGGGCGGTGTCCTTGCTATTGTATGCCTAATCGGTGGCGATTGCGACACAACAAAAACTCGTATAACGAGATTTGCCAACTATCTTCGCAATCTTCTACCATCTTCTGATGTGGGAGTGATGGAACTAGCTGCTAAAACTGTCGGTCGTCTTGCTACTGTGTCAGGTATTAAGAGGGCAGAGTATGTAGAATTCGAAGTTAAAAGAGCATTTGAGTGGTTGTCCGAAGAACGCAATGAAGGAAGACGCCACTCAGCAGTCTTACTTCTTAAAGAACTAGCCATAGCAATGCCAACATATTTTTATCAGCAAGTTTCAGGTTTCTTTGATCACATTCTAATAGCACTCAAAGATCCAAAGCAGCAAATCCGTGAAGCTGCAGCCAAGGCTCTGAGAGCTGGCTTGGTGGTGACTTCGCAGAGAGAAACAGCAAAGCAATCAACAGCAAAACTTCAGTGGTACATGCAGTGCTACGAAGAAGCTATGTTTTCTTTTGAAGACATACCATTAAAAGAAAAGAGCATGACCAAAGAGGATAGAGTGCATGGAGGATTATTAATATTGAATGAACTCTTAAGATGTTCAAATTCTGTTTGGGAAAAGAAGTACACACAGTTCATACACAACTTTGACACACAAAAAGACTTGACAGTCTCTGATGATATCATTTTTATAAGCGCTAAGTTGCACAGTCCTTCAGTCAAACGTGGATACTTGTGTGACGGTTTTAAAACTGAGAATGTTCAATATCCTGTGCCTATCTATGAATCAGCAGTATGTCGTAAACTACTTACTGAAAAGTTTGAGAAGATTTGTCAAGATGTTATGGCTCAACGGGTATTGAAGATACAAGGGATACCACAAATATTACTTATAATAATTCCAAGATTGGCAGCTTTCAATAAAGAGTTTTTTCTAAAAAAATATTTTAGTACAACAATGCACTACTTGATCACATGTCTTCGTAGTAGAGAAAAAGACAAAAATGTTGCTTTTACAACAATAGGTTTGATGGCGGCTGCTCTAGAGAATGATATAAAGAATTATATTCCAAGAATCATGGAGGTTATAAAACAAGCTTTGCCTGTAAGAGATACACTAACAAAAAAGAGAATTTGGGTTGATCCATCTATTTTTGCATGTATAACTTTACTGGCTGGTACAGTTAAAGATCTAGTGGTTAATGATATAAAAGAACTCTTGGATCCAATGTTTGCTACTGGACTTAGCCCATCATTAACCATATGCCTCAGAGAGCTCAGTCTAAGCTTACCAAATCTCAGAAGGGAAATATCGGAAGGCTTACTAAATATGCTTTCAATTGTTTTAAGAAACAAACCATTTTTGCATCCTGGTGTACCACATTCTTTAGAACAACAAATGAGTAACATGAGTCTTGTGATAGAAGTACAAGATTCAGCCAGTGTAGTATTGGCATTACGCACATTGGGCACGTTTCATTTTGAAGGACAACACAGCTTATTAATGTTTGTTAGGCGCTGTGCAGAACACTTCTTGCTAAGTGATCAACAAGAAATTAGACTTGAAGCAGTTAAAACATCAGCAAAATTATTGGCTGATGCTACAATCAGAACTATCAACAGCCCATCTAGAACACTCACATTGTTAACTGCAGAGGTCATAGGCAAATTGTTAATTGTTGCAGTCACGGATCCTGACTATGAAGTACGTTATTGGGTATTAGAATCACTAACTGATATATTTGATATTCATTTGGCACAAGTTGAAAATCTTACTTTCCTTTTTATGGCCATGAATGATGAACACCTGTCCATTCGTGAATTGGCAATTTGTACAGTGGGACGTCTTAGTGCTGTGAACCCTGCCTATGTTATGCCAGGTCTTAGAAAAGTTTTGATACAATTCTTAACCGAATTAGAACACTCTGGAATGAGTAGAAATAAGGAGCAAGCAGCAAGAATGCTTGACAATTTAATACTACATGCACCGAAACTTGTAAAACCTTACATGGAAACAATACTTAATGTTTTGGTTCCAAAACTGAAAGAATCCGACTCTAATCCAGGTGTTGTAATCAGTGTATTGAAAGCGATTGGAGATTTGGCAGATGTACATGGAGACAATACTGGGCTGAAAAAATGGCTTCCCGAACTTTTGTCTATACTGTTGGAATTATTATCAGACGCGAGTGCCACTGAGAAAAGAAGTGTTGCGCTGTGGGCATTCGGACAACTAATTAGTGCTACTGGACATGTAGTAACTCCTTACACCGAATACCCAAACCTTATGGATGTACTGTTAAATTTCCTGAAAACTGAACAACAACCTAAAGATAGAAGGGAAACTATACGCGTTTTGGGTTTACTCGGTGCTTTAGATCCTTACAAGCACAAAATGACAAAAGGGATGAAGGTCGATTCCACACTTGTCCCTGTCACTGATAGCAAATCTGAAGGAAACAATTTTGATATGACTACCAGTGAAATGCTAGTTAATATGTCTTCCCCTGTTTTAGATGAGTACTATCCGGCAATCGTTATATCAACACTAATGCGGATATTACGTGATCCAACCTTACAACAGCATCACACTAATGTAGTTCAGGCTGTGACCTTTATATTCCAATCTTTAGGTATTAAATGTGTTCCGTACATATCTCGCGTGACCCCAAGCCTCTTGTACGTAGCGCGGGCGACTGATAACAACAACTTCCGCGAATTCCTTTTCACACAACTAGCGAGGCTAATCGCCATCGTGAAACAACACATACGCAATTATTTGGACAAGATATTTGATCTAATTAAGGAATTTTGGACGCCAAACAGCTTTCTACAACCGACGTTAATACTGTTAGTAGAATACATAGCCATAGCTCTCGGCTCGGAATTTAAGGTGTATTTACCACAGTTGATGCCTCAAATACTGCGCGTACTTGCGCATGATACTAGTAAAGATCGCGTGGTCACTGAAAAGCTTTTATATGCTCTACAAAAGTTCGAGGATAACCTTGACGACTACATGCATCTCGTAATACCGTCTATCGTTAAATTGTTTGACGCCTCCGATTGTCCAATTCATGTAGCTAAGGTGGCGATGGAAACAGTAGACATATTATCAGACTCTCTCAGTTATAATGAATTGGTTTCGAGAATCATCCACCCGCTTGTGCGGAGCCTAGATTCGTGCGCTCCACTAAGACAAACGGCAATGGACACCTTATGCGCCTTGATAGTGCAGCTAGGTAGAAAATATACCGATTTCATACCTCTAGTACAAAAAGTGGTGGTTAAACATAAAATACAGCATCAAAATTACGAACTTCTATTGTCAAGATTACAGTCTAGTCAAACTTTAGCTATGCATGAGTTTCTCCAAAGTACGAGGCGTAGGCCCAGAAATAACAACCAAGAGGCTCGTATCATAGTATGTGACACATCACAGTCCATTCGCAAGTTATGTGTGAACGCTCATAGTTTGAAGCTTGCCTGGACTGTAAGCAGTCGTGTGTCTAAAGATGACTGGTTGGAGTGGCTTCGGCGGTTCAGCATTGGATTGCTAACCGAATCTCATAGCCCTGCTCTAAGGGCGTGTTTAGATCTTGCCCACAATTATTCTCAACTTTTGCGAGACTTGTTCAACGCGGCCTTCGTATCCTGTTGGACTGAGTTAGACGACACCTCGCGCACCGAACTGTCGAATGCGTTAGAACAGGCCTTAACTGCTCCAGACGCGCCGGAGCTGGCGCACACTGTGCTAAATCTGGCCGAATTCATGGAACACTGTGAAGGAGGCGCTTTGCCAATATCCACACAACTTTTGGGAGAACGGGCTATGCACTGTAGAGCATATGCCAAAGCTCTTCATTACAAGGAAGAAGAGTTCCGCAATGGCGCCACTTCACAAGTTGTAGAAGCTTTGATTCATATTAATAATAAATTGCAACAAAAAGAAGCAGCTGAAGGTCTATTGGAAAGAGTAATGGCTCAACGTGAAGCCGGGGACACGAATCTGAAAGTGCAAATCAGATGGTATGAAAAATTGCACAATTGGGAAAAAGCACTTAATCTGTACAGCGAAAAATTGTCAGCAGACCCTGACGATGTGGATGCATATCTCGGTGAACTACGTTGTTACGAAGCTTTAGGAGAGTGGTTAAAATTATACAATACAGTTTCAGAAAGTTGGGTTAAAATGGGTACTGACGAAAAATACAAAGCGGCCAGATTAGCCGCTGCAGCTGCGTGGGGCCTCAATGAATGGGATTCGATGGCAAAGTATGTAAATTTCCTACCCGAGAACACCCAAGACGGTGCTTTCTACAGAGCTGTTCTTAACATTCACAATGGTGAATATAAAGTATCAAAACAATTCATAGACTTAGCACGAACATTGCTGGATTCAGAACTAACTGCAGTGGCTGGAGAAAGCTATCAAAGAGCTTATGGAGCTCTGGTAAACGCTCAGTTACTTGCCGAATTAGAAGAAGTGATCACATATAAATTGGTAAATGAAAGAAGGGAAACCATTCGCCAAGCCTGGTGGACAAGGTTGCAAGGTGGCCAAAGATTGGTTGAAGACTGGCGTAGAATCTTACAAGTTCGTAGCTTAGTTCTTACGCCGCAAGAAGATATGGCTACTTGGCTTAAGTTCGCATCGTTGTGTAGGAAGAGTGGTGCTCCACGGCAAGCCCACAAAACTTTGGTGATGCTACTCGGTACTGATCCCAGCAAAAATAGAGATATGCCTCTTCCGACGCACGAGCCAAGATTGACTTTGGCCTACGCCAAGCACTTGTGGGTTGCTGGAGATAAACAGCTTGCGTACGATCAGCTTCAGCGTTACATCATCGGCACTGAAACTGGAGATGCTGACCACTGCAGACTATTGGCGCGATGCCATTTGAAATTGGGATCGTGGTGTGAATCTCTACTCGGAATCAATGAACATTCCATACCGGAAATATTGAGAAATTACGCGGCTGCCACAGAGTTGTCGTCCGATTGGTACAAAGCCTGGCATGCGTGGGCCTACATGAATTTTGAGACTGTGCTTTTCTACAAACATCAAGATACCAATTCCGGCCGCACCCTTTCTGGTGAGCGAAAAATGAGCCCCGAATGCATTCAACAGCACACGGTTCCCGCCGTAGAAGGCTTCTTTAAATCAATCTATTTGTCACACGGCAGCTCTTTACAAGATACATTACGATTGTTGACTTTGTGGTTTGACTATGGTCACTATCCCGCCGTACATGAAGCGCTCGTAGAGGGTATTAGAACTATTGAAATAAACGTGTGGCTCCAAGTCATACCGCAGCTCATCGCCAGAATCGACACACCTCGACCCCTAGTTGGGAAACTCATTCACTCATTACTCATCGACATTGGAAAGTCACATCCGCAAGCTCTTGTGTATCCATTGACGGTGGCCTCTAAATCGTCATTTGTGGCCCGAAAGAACGCAGCGAATCACATATTGAAGTCTATGTGTACTCATTCAAGCAATTTAGTCAATCAGGCCGCGATGATTTCGGAGGAACTGATCAGAGTAGCTATTTTGTGGCACGAACAATGGTATGAGGCATTAGAGGAAGCTTCTAGATTATATTTCAGCGAAAACGACGTTAATGCTATGCTGAAAACGCTGGAACCACTGCATGCTATGTTGGAGAGGGGACCGGAAACGGTAAAGGAAGCTTCGTTCAGCCACGCTTACAGCCGAGAACTTAACGAGGCACAAGATTGGTGCAACCGATATAAGGAATCTGGTCAGGTGCGAGATCTGAACCAAGCGTGGGACCTGTACTACCACGTGTTCCGTCGCATCAGCCGGCAGCTGCCGCAGCTGACGTCGCTGGAGCTGCAGTACGTGTCGCCGCGGCTGCTGAACTGCCGCGACCTGGAGCTCGCGGTGCCCGGCTCCTACGTGCCCGACCAGGACCTCATACGCATCGCGCATATACAGAGCAGCCTGCAGGTGATAAGTTCTAAACAAAGACCACGTCGTCTCTGCATCCGCGGTTCGAACGGTAAAGACTACATGTTCCTGCTGAAGGGTCACGAAGACCTCCGTCAAGACGAAAGAGTGATGCAGTTGTTCGGTCTCGTGAACACGCTGCTGCAGGCCGACCCGGACACTTTCCGGCGTGACCTGGCCATACAGAGATACGCGGTCATCCCGCTCTCCACTAATTCGGGTCTCATTGGCTGGGTGCCGCACTGTGACACTCTGCACTTCCTCATCAAAGATTACAGGGACAAACGCAAGTGTTTGTTGAACATCGAACACAGAATCATGCAACGGATGGCCTCAGATCTCGATAAATTGATGCTAATGCAAAAGGTGGAAGTTTTTGAGCATGCTCTAGAGCATACGGTCGGTGACGATTTGGCGAAGTTGTTATGGCTGAAGAGTCCGTCGTCGGAGGTGTGGTTCGAGCGGCGCACCAACTACACGCGCTCGCTCGCCGTCATGAGCATGGTGGGCTACATCCTCGGCCTCGGGGACAGGCACCCGTCCAACATCATGCTCGACAGGGTCACCGGAAAATTTTTGCATATTGACTTTGGTGATTGCTTCGAAGTTGCTGTCACGAGAGATAAATTCCCGGAGAAGATTCCGTTTAGGTTGACTAGGATGCTCATTAATGCCATGGAGGTGACAGGCATCGAAGGAACGTACCGCCGAACATGCGAGTCCGTGATGGAAGTACTGCACCGACACAAAGACAGCGTGATGGCCGTGCTCGAGGCCTTCGTGTACGACCCGCTGCTGAACTGGAGGCTCATCGAGGCGACGCGGCGCTCGCGGGCCGACCCCGACGCGTGCCCCGCGGAGCCCGCCAGCCCGCCGCGCGACCCCCCGCGCGAGCCCCCGCGAGACCTCCCGCGCGACCCGGCGCAACCCGCCGAGGCCAACCTCAACAAGCGCGCCCTCTCCATCGTGAACCGCGTCCGGGACAAGCTCACGGGCCGCGACTTCCCGCACATCGACGAGACGGTGTCCGTGCAGAAACAAGTCGACCTGCTCATCCAGCAGGCGACCAGCAACGAGAACTTATGTCAGTGCTATGTCGGCTGGTGTCCGTTTTGGTGA
Protein
MSNQVAQFVSGLKSRTVDIQIKTARELYHYAKTELREVPQEELTQFLDEFNHQIFEMVSSNDVHEKKGGVLAIVCLIGGDCDTTKTRITRFANYLRNLLPSSDVGVMELAAKTVGRLATVSGIKRAEYVEFEVKRAFEWLSEERNEGRRHSAVLLLKELAIAMPTYFYQQVSGFFDHILIALKDPKQQIREAAAKALRAGLVVTSQRETAKQSTAKLQWYMQCYEEAMFSFEDIPLKEKSMTKEDRVHGGLLILNELLRCSNSVWEKKYTQFIHNFDTQKDLTVSDDIIFISAKLHSPSVKRGYLCDGFKTENVQYPVPIYESAVCRKLLTEKFEKICQDVMAQRVLKIQGIPQILLIIIPRLAAFNKEFFLKKYFSTTMHYLITCLRSREKDKNVAFTTIGLMAAALENDIKNYIPRIMEVIKQALPVRDTLTKKRIWVDPSIFACITLLAGTVKDLVVNDIKELLDPMFATGLSPSLTICLRELSLSLPNLRREISEGLLNMLSIVLRNKPFLHPGVPHSLEQQMSNMSLVIEVQDSASVVLALRTLGTFHFEGQHSLLMFVRRCAEHFLLSDQQEIRLEAVKTSAKLLADATIRTINSPSRTLTLLTAEVIGKLLIVAVTDPDYEVRYWVLESLTDIFDIHLAQVENLTFLFMAMNDEHLSIRELAICTVGRLSAVNPAYVMPGLRKVLIQFLTELEHSGMSRNKEQAARMLDNLILHAPKLVKPYMETILNVLVPKLKESDSNPGVVISVLKAIGDLADVHGDNTGLKKWLPELLSILLELLSDASATEKRSVALWAFGQLISATGHVVTPYTEYPNLMDVLLNFLKTEQQPKDRRETIRVLGLLGALDPYKHKMTKGMKVDSTLVPVTDSKSEGNNFDMTTSEMLVNMSSPVLDEYYPAIVISTLMRILRDPTLQQHHTNVVQAVTFIFQSLGIKCVPYISRVTPSLLYVARATDNNNFREFLFTQLARLIAIVKQHIRNYLDKIFDLIKEFWTPNSFLQPTLILLVEYIAIALGSEFKVYLPQLMPQILRVLAHDTSKDRVVTEKLLYALQKFEDNLDDYMHLVIPSIVKLFDASDCPIHVAKVAMETVDILSDSLSYNELVSRIIHPLVRSLDSCAPLRQTAMDTLCALIVQLGRKYTDFIPLVQKVVVKHKIQHQNYELLLSRLQSSQTLAMHEFLQSTRRRPRNNNQEARIIVCDTSQSIRKLCVNAHSLKLAWTVSSRVSKDDWLEWLRRFSIGLLTESHSPALRACLDLAHNYSQLLRDLFNAAFVSCWTELDDTSRTELSNALEQALTAPDAPELAHTVLNLAEFMEHCEGGALPISTQLLGERAMHCRAYAKALHYKEEEFRNGATSQVVEALIHINNKLQQKEAAEGLLERVMAQREAGDTNLKVQIRWYEKLHNWEKALNLYSEKLSADPDDVDAYLGELRCYEALGEWLKLYNTVSESWVKMGTDEKYKAARLAAAAAWGLNEWDSMAKYVNFLPENTQDGAFYRAVLNIHNGEYKVSKQFIDLARTLLDSELTAVAGESYQRAYGALVNAQLLAELEEVITYKLVNERRETIRQAWWTRLQGGQRLVEDWRRILQVRSLVLTPQEDMATWLKFASLCRKSGAPRQAHKTLVMLLGTDPSKNRDMPLPTHEPRLTLAYAKHLWVAGDKQLAYDQLQRYIIGTETGDADHCRLLARCHLKLGSWCESLLGINEHSIPEILRNYAAATELSSDWYKAWHAWAYMNFETVLFYKHQDTNSGRTLSGERKMSPECIQQHTVPAVEGFFKSIYLSHGSSLQDTLRLLTLWFDYGHYPAVHEALVEGIRTIEINVWLQVIPQLIARIDTPRPLVGKLIHSLLIDIGKSHPQALVYPLTVASKSSFVARKNAANHILKSMCTHSSNLVNQAAMISEELIRVAILWHEQWYEALEEASRLYFSENDVNAMLKTLEPLHAMLERGPETVKEASFSHAYSRELNEAQDWCNRYKESGQVRDLNQAWDLYYHVFRRISRQLPQLTSLELQYVSPRLLNCRDLELAVPGSYVPDQDLIRIAHIQSSLQVISSKQRPRRLCIRGSNGKDYMFLLKGHEDLRQDERVMQLFGLVNTLLQADPDTFRRDLAIQRYAVIPLSTNSGLIGWVPHCDTLHFLIKDYRDKRKCLLNIEHRIMQRMASDLDKLMLMQKVEVFEHALEHTVGDDLAKLLWLKSPSSEVWFERRTNYTRSLAVMSMVGYILGLGDRHPSNIMLDRVTGKFLHIDFGDCFEVAVTRDKFPEKIPFRLTRMLINAMEVTGIEGTYRRTCESVMEVLHRHKDSVMAVLEAFVYDPLLNWRLIEATRRSRADPDACPAEPASPPRDPPREPPRDLPRDPAQPAEANLNKRALSIVNRVRDKLTGRDFPHIDETVSVQKQVDLLIQQATSNENLCQCYVGWCPFW

Summary

Catalytic Activity
ATP + L-seryl-[protein] = ADP + H(+) + O-phospho-L-seryl-[protein]
ATP + L-threonyl-[protein] = ADP + H(+) + O-phospho-L-threonyl-[protein]
Similarity
Belongs to the PI3/PI4-kinase family.
EC Number
2.7.11.1
EMBL
GU350773    ADB91964.1    NWSH01000622    PCG75228.1    PCG75229.1    KZ149902    + More
PZC78469.1    ODYU01010861    SOQ56225.1    KQ459562    KPI99850.1    KQ459989    KPJ18652.1    AGBW02009978    OWR49427.1    JTDY01001304    KOB74250.1    NEVH01016943    PNF25178.1    EU926975    ACH47049.1    KZ288215    PBC32626.1    KK853598    KDR06409.1    KQ414735    KOC62255.1    KQ435127    KZC14833.1    GBYB01004751    JAG74518.1    GBYB01004754    JAG74521.1    GEDC01021234    JAS16064.1    KK107119    EZA58683.1    GL443520    EFN61954.1    ADTU01027564    KQ978426    KYM94028.1    KQ976730    KYM76409.1    KQ981993    KYN31116.1    NNAY01001912    OXU22583.1    SOQ56223.1    PZC78466.1    GL763054    EFZ20258.1    PCG75224.1    GEZM01054727    JAV73459.1    GL452770    EFN76766.1    KQ971362    EFA07964.1    KQ982974    KYQ48590.1    JQ793898    AFJ74724.1    GU350772    ADB91963.1    CH477199    EAT48240.1    KP187832    AKB11618.1    DS235250    EEB13969.1    ACPB03017386    ACPB03017387    AY438003    AAR97336.1    HQ875574    AEA11029.1    UFQS01002589    UFQT01002589    SSX14318.1    SSX33729.1    UFQS01002850    UFQT01002850    SSX14750.1    SSX34142.1    QOIP01000009    RLU18582.1    SSX14319.1    SSX33730.1    GFTR01008965    JAW07461.1    JXUM01031780    JXUM01031781    KQ560935    KXJ80282.1    KR075825    ALE20544.1    CVRI01000063    CRL04799.1    GDHC01020467    GDHC01011432    JAP98161.1    JAQ07197.1    DS231887    EDS43487.1    GGMS01003246    MBY72449.1    PCG75225.1    GFXV01008113    MBW19918.1    AMQN01009177    KB304845    ELU01654.1    AAAB01008964    EAA12914.4    GEFH01002011    JAP66570.1    AB716688    BAM65820.1    APGK01056781    KB741277    KB632196    ENN71118.1    ERL89980.1    GFPF01007816    MAA18962.1    JRES01000681    KNC29211.1    GEDV01007348    JAP81209.1    KA644695    AFP59324.1    GBXI01012713    JAD01579.1    JXJN01026847    GAMC01017478    JAB89077.1    FJ167395    ACN38706.1    JXJN01008153    GACK01003463    JAA61571.1    GACK01000900    JAA64134.1    GCES01147442    GCES01146654    JAQ38880.1    KY985002    ATA63314.1    AERX01021209    AERX01021210    AERX01021211    AYCK01000644    AYCK01000645    AYCK01000646    AYCK01000647    AYCK01000648    AYCK01000649    AYCK01000650    AYCK01000651    AYCK01000652    AYCK01000653    KJ746670    AIG52217.1    HADW01005382    HADX01014075    SBP36307.1    HAEB01017871    SBQ64398.1    KK114864    KFM63533.1    AHAT01009817    HAEI01000071    SBR70062.1    GGLE01005135    MBY09261.1    HAED01004185    SBQ90215.1    HADY01020931    HAEJ01013724    SBS54181.1    HAEA01014336    SBQ42816.1   
Pfam
PF11865   DUF3385        + More
PF02259   FAT
PF00454   PI3_PI4_kinase
PF08771   FRB_dom
PF02260   FATC
PF02985   HEAT
PF06424   PRP1_N
Interpro
IPR016024   ARM-type_fold        + More
IPR036940   PI3/4_kinase_cat_sf       
IPR036738   FRB_sf       
IPR011990   TPR-like_helical_dom_sf       
IPR024585   DUF3385_TOR       
IPR000403   PI3/4_kinase_cat_dom       
IPR018936   PI3/4_kinase_CS       
IPR011009   Kinase-like_dom_sf       
IPR014009   PIK_FAT       
IPR009076   FRB_dom       
IPR003152   FATC_dom       
IPR011989   ARM-like       
IPR003151   PIK-rel_kinase_FAT       
IPR026683   TOR       
IPR013026   TPR-contain_dom       
IPR019734   TPR_repeat       
IPR000357   HEAT       
IPR003107   HAT       
IPR010491   PRP1_N       
IPR021133   HEAT_type_2       
IPR000504   RRM_dom       
IPR035979   RBD_domain_sf       
IPR012677   Nucleotide-bd_a/b_plait_sf       
SUPFAM
SSF48371   SSF48371        + More
SSF56112   SSF56112       
SSF47212   SSF47212       
SSF48452   SSF48452       
SSF54928   SSF54928       
PDB
5ZCS     E-value=0,     Score=6778

Ontologies

Topology

Length:
2424
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.258580000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00766
outside
1  -  2424
 
 

Population Genetic Test Statistics

Pi
251.918352
Theta
183.654546
Tajima's D
1.03124
CLR
0.223765
CSRT
0.669416529173541
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号