SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01374
Annotation
PREDICTED:_uncharacterized_protein_LOC101737183_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.553
 

Sequence

CDS
ATGGACACTGCACCCGGCCCGGACGGCGTCCATGGTCGGGTTTGGGGCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACCGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGTATTCTGGCAGCCCGCATCATCCAGCATCTGGCCGGGGTGGGACCCGATCTGTCGGCGGAACAGTATGGCTTCCGAGAGGGCCGCTCAACCGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGCGGGGTGGCCCTGGCGGTATCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAAAGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACCGGACATGATGGGATCGTGCACCGATTCCCGGTCGTACGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTCTGTGGAATATCGGGTATGACTGGGTGCTAAGAGGTGCCCTCCTCCCGGGCCTGAGTGTAATCTGCTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGTTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCACTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTATCGATGCTCAAATCGTGGTTGGAGGCGTCCGTATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGGGTGGTGCGGTCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCAAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGCGGCTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACTTTCGTGCCCGGGGCGTGGCGCGCCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAATCATGGTCCAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCAGTCCTTGTGGACTGGGCGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGACATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGACAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCGCAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATATCGCCCAAGCCCTGGCCCTCTAA
Protein
MDTAPGPDGVHGRVWGLALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLAGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHDGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATVGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPIDAQIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADFRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWANRDRGRLTFRLTQVLTGHGCFGEFLHRIRAEPTTECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADIAQALAL

Summary

Similarity
Belongs to the AB hydrolase superfamily. Lipase family.
EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078930    BAC06454.1    + More
AB078931    BAC06456.1    AB078929    BAC06452.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    D85594    BAA19776.1    KQ460685    KPJ12887.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01006063    KMQ90967.1    LBMM01005707    KMQ91279.1    LBMM01006657    KMQ90417.1    LBMM01005733    KMQ91252.1    LBMM01004272    KMQ92618.1    LBMM01005948    KMQ91066.1    LBMM01007036    KMQ90099.1    LBMM01002052    KMQ95336.1    LBMM01004634    KMQ92224.1    LBMM01008682    KMQ88705.1    LBMM01008422    KMQ88894.1    LBMM01002480    KMQ94776.1    LBMM01015018    KMQ84954.1    LBMM01019839    KMQ83438.1    LBMM01007425    KMQ89740.1    LBMM01003988    KMQ92922.1    GGMR01014195    MBY26814.1    LBMM01019838    KMQ83439.1    LBMM01008448    KMQ88867.1    LBMM01015025    KMQ84953.1    LBMM01003245    KMQ93755.1    LBMM01012412    KMQ86235.1    LBMM01004505    KMQ92346.1    LBMM01008278    KMQ89009.1    GGMR01000779    MBY13398.1    LBMM01003575    KMQ93366.1    LBMM01014122    KMQ85315.1    KMQ94772.1    LBMM01005465    KMQ91492.1    LBMM01005474    KMQ91485.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    ABLF02011238    GGMR01015159    MBY27778.1    LBMM01006725    KMQ90373.1    ABLF02014378    GFXV01002090    MBW13895.1    ABLF02013358    ABLF02013361    ABLF02054869    ABLF02016340    GGMR01011682    MBY24301.1    GGMR01004600    MBY17219.1    LBMM01014956    KMQ84982.1    ABLF02034925    LBMM01006662    KMQ90413.1    LBMM01005216    KMQ91703.1    ABLF02041886    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    LBMM01004262    KMQ92649.1    LBMM01004261    KMQ92650.1    GGMR01006838    MBY19457.1    ABLF02011183    ABLF02041884    ABLF02018808    GFXV01003903    MBW15708.1    GGMR01015354    MBY27973.1    ABLF02005203    ABLF02041316    KU543683    AMS38371.1    GALA01001777    JAA93075.1    ABLF02018942    ABLF02041885    LBMM01006977    KMQ90149.1    APGK01005465    KB736249    ENN83233.1    ABLF02041557    LBMM01015285    KMQ84870.1    ABLF02004854    ABLF02041317    HACL01000281    CFW94575.1    GALA01000302    JAA94550.1    GALA01001776    JAA93076.1    GAKP01002292    JAC56660.1    ABLF02010223    ABLF02023257    ABLF02021100    QOIP01000014    RLU15074.1    KU543679    AMS38363.1    GALX01004785    JAB63681.1    ABLF02007989    ABLF02004597    ABLF02041324    ABLF02059310   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF00098   zf-CCHC
PF13966   zf-RVT
PF00151   Lipase
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR026960   RVT-Znf       
IPR029058   AB_hydrolase       
IPR013818   Lipase/vitellogenin       
IPR000734   TAG_lipase       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53474   SSF53474       
Gene 3D
PDB
6AR3     E-value=1.15498e-05,     Score=118

Ontologies

Topology

Subcellular location
Secreted  
Length:
579
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.13313
Exp number, first 60 AAs:
0.00935
Total prob of N-in:
0.00149
outside
1  -  579
 
 

Population Genetic Test Statistics

Pi
4.213734
Theta
20.86243
Tajima's D
1.114142
CLR
0.397194
CSRT
0.697965101744913
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号