SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01346  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA009000
Annotation
PREDICTED:_succinate_dehydrogenase_[ubiquinone]_flavoprotein_subunit?_mitochondrial_[Papilio_xuthus]
Full name
Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial       + More
Succinate dehydrogenase (quinone)      
Alternative Name
Flavoprotein subunit of complex II
Succinyl coenzyme A synthetase flavoprotein subunit
Location in the cell
Mitochondrial   Reliability : 2.997
 

Sequence

CDS
ATGAGTGCATTAATGAAAGCGGCAGTTTCCCGCAGTCCTGCGTCACTGGCATCATACTTATATAGAAATATTCACGTGGCTGCTTCTGGTGCTACTTCTAAAGATGCTTCAGTTACAACAAATATGACTAAAGCATACACAGTAATTGACCACAAACATGATGCATTAGTTATTGGGGCTGGTGGAGCAGGACTTCGAGCAGCCTTTGGTCTTGTCCAAGAAGGATTTAAAACTGCTGTCGTAACTAAGTTGTTCCCTACAAGATCACATACTGTTGCTGCACAGGGTGGAATTAATGCTGCTTTGGGAAACATGGAGGAAGACAGTTGGCTCTGGCATATGTATGACACAGTTAAAGGTTCCGACTGGCTTGGAGATCAGGATGCCATTCACTACATGACTAAAGAAGCGCCTCATGCAGTAATCGAACTGGACAACTACGGAATGCCATTCTCCCGCACCCCGGAGGGAAAGATTTACCAGAGGGCCTTCGGAGGACAGTCTCTCAAGTTCGGAAAGGGAGGACAAGCTCATAGATGCTGCGCCGTAGCTGACAGAACCGGGCACTCCCTCCTTCACACGCTGTACGGCCAATCACTCCGCTACGACTGCGAATACTTCATCGAGTATTTCGCTCTCGATTTGCTAATGGAAGACGGAGTCTGCAAGGGATGCATCGCCATCAATCTCGAAGACGGAACACTGCACAGGTTCCAAGCGAAGAATACGATCTTGGCCACGGGAGGCACCGGCCGCTCATACTTCAGTTGCACGTCGGCGCACACCTGCACAGGGGACGGCACCGCCATGGCCGCTCGAGTCGGTCTGCAGAACGAGGATATGGAGTTTGTGCAGTTCCATCCAACTGGTATCTACGGCGCCGGTTGCCTGATGACCGAGGGTTGTCGTGGCGAGGGCGGCTTCCTGGTCAACTCGAAGGGCGAACGGTTCATGGAACGTTACGCGCCCGTCGCCAAGGACCTGGCCAGTCGAGACGTGGTCTCGCGTGCTATGACGGTTGAAATTATGGAAGGTCGCGGTTGCGGCCCGGAGAAGGACCACGTTCACCTACAGTTGCACCACCTGCCTCCCGAACAACTGAAGCAGCGTCTGCCTGGCATCTCGGAGACGGCCATGATCTTCGCTGGGGTCGACGTCACTAAGGAACCCATTCCTGTGCTACCGACAGTGCACTATAATATGGGTGGTACTCCCACCAATTTCCGCGGGGAGGTGATCACGCACCGTGGCGGCGCGGACCGCGTGGTGGCGGGGCTGCTGGCGGCGGGCGAGGCGTCGTGCGCCAGCGTGCACGGCGCCAACCGGCTGGGCGCCAACTCGCTGCTGGACATCGTGGTGTTCGGCCGCGCCTGCGCACTCACCGTGGCCGACACGGCGCGCCCCGGGGACCCGCAGCCGCCGCTCGCGCCCACAACGGGCGAGGCGAGCATTGCCAACTTGGACAGCATCAGATACGCCAATGGTTCGATCTCTACAGCCGACCTTAGACTTAGAATGCAAAAATGCATGCAGAAGAATGCCGCCGTCTTTAGACAGAAGAGCACCTTGGAGGAAGGTCAACGTCAAATTCACGAGATCTACAAGCAGATAAAAGACGTGAAGGTGTCCGACCGGTCCTTGATCTGGAACAGTGATCTAGTGGAGACGCTGGAGCTTCAGAATCTTCTCATCAACTCGGTACAGATCGTGGAGGGAGCACTGGCGCGGGAGGAGTCGCGCGGAGCCCACGCCCGAGAGGACTTCAAGACCAGACGCGACGAGTACGACTACTCTAAACCTCTCGAGGGACAGAGTAAGTTGCCGTTCGAGCAGCACTGGAGGAAGCACACGCTCGCCGAGACGGACCCCGCGACCGGCGACACGCGCCTCACCTACCGCCCCGTCATCGACCGCACGCTCGACGCCGCCGAGTGCAGCACCGTGCCGCCCGTCATCCGCACCTACTAG
Protein
MSALMKAAVSRSPASLASYLYRNIHVAASGATSKDASVTTNMTKAYTVIDHKHDALVIGAGGAGLRAAFGLVQEGFKTAVVTKLFPTRSHTVAAQGGINAALGNMEEDSWLWHMYDTVKGSDWLGDQDAIHYMTKEAPHAVIELDNYGMPFSRTPEGKIYQRAFGGQSLKFGKGGQAHRCCAVADRTGHSLLHTLYGQSLRYDCEYFIEYFALDLLMEDGVCKGCIAINLEDGTLHRFQAKNTILATGGTGRSYFSCTSAHTCTGDGTAMAARVGLQNEDMEFVQFHPTGIYGAGCLMTEGCRGEGGFLVNSKGERFMERYAPVAKDLASRDVVSRAMTVEIMEGRGCGPEKDHVHLQLHHLPPEQLKQRLPGISETAMIFAGVDVTKEPIPVLPTVHYNMGGTPTNFRGEVITHRGGADRVVAGLLAAGEASCASVHGANRLGANSLLDIVVFGRACALTVADTARPGDPQPPLAPTTGEASIANLDSIRYANGSISTADLRLRMQKCMQKNAAVFRQKSTLEEGQRQIHEIYKQIKDVKVSDRSLIWNSDLVETLELQNLLINSVQIVEGALAREESRGAHAREDFKTRRDEYDYSKPLEGQSKLPFEQHWRKHTLAETDPATGDTRLTYRPVIDRTLDAAECSTVPPVIRTY

Summary

Description
Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q).
Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q). Maintaining electron transport chain function is required to prevent neurodegenerative changes seen in both early- and late-onset disorders.
Catalytic Activity
a quinone + succinate = a quinol + fumarate
Cofactor
FAD
Subunit
Component of complex II composed of four subunits: a flavoprotein (FP), an iron-sulfur protein (IP), and a cytochrome b composed of a large and a small subunit.
Similarity
Belongs to the FAD-dependent oxidoreductase 2 family. FRD/SDH subfamily.
Keywords
Complete proteome   Electron transport   FAD   Flavoprotein   Membrane   Mitochondrion   Mitochondrion inner membrane   Oxidoreductase   Reference proteome   Transit peptide   Transport   Tricarboxylic acid cycle  
Feature
chain  Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial
EC Number
1.3.5.1
EMBL
BABH01012716    BABH01012717    KZ149894    PZC78885.1    AGBW02008935    OWR52136.1    + More
KC161216    AGJ76544.1    GFDL01002556    JAV32489.1    GFDL01002555    JAV32490.1    GFDL01002551    JAV32494.1    GFDL01002549    JAV32496.1    AAAB01008849    EAA07202.4    AXCM01000168    APCN01005154    ATLV01016449    KE525091    KFB41348.1    KM098145    AIS22434.1    GGFJ01003028    MBW52169.1    AXCN02001756    GGFM01006662    MBW27413.1    ADMH02000002    ETN68137.1    GGFK01002760    MBW36081.1    GBHO01021610    GBRD01008830    GDHC01008054    JAG21994.1    JAG56991.1    JAQ10575.1    GGFK01002780    MBW36101.1    NEVH01016943    PNF25089.1    JXUM01099388    KQ564488    KXJ72205.1    GECU01003842    JAT03865.1    GANO01001255    JAB58616.1    AK417890    BAN21105.1    AJWK01017478    AJWK01017479    AJWK01017480    AJWK01017481    AJWK01017482    AJWK01017483    DS231921    EDS26512.1    GFDF01001754    JAV12330.1    HACA01024595    CDW41956.1    CH963894    EDW77148.1    KRF98587.1    CP012524    ALC41853.1    GALA01001749    JAA93103.1    KY027056    ATP16742.1    CH479181    EDW31689.1    GL440811    EFN65418.1    CM000071    EAL24918.1    KRT01692.1    LBMM01000341    KMR00218.1    LJIJ01000544    ODM96389.1    GEDC01003948    JAS33350.1    CH477675    EAT37381.1    OUUW01000001    SPP75142.1    KA645063    AFP59692.1    CM002911    KMY95086.1    CH954179    EDV55204.1    CM000158    EDW91502.1    AE013599    AY051472    BT099627    Y09064    GDIQ01184056    JAK67669.1    GAPW01000570    JAC13028.1    CH940648    EDW60557.1    KRF79479.1    GDIP01165779    JAJ57623.1    UFQS01000020    UFQT01000020    SSW97497.1    SSX17883.1    GDIP01198727    JAJ24675.1    GDIP01200173    JAJ23229.1    GDIP01128530    GDIP01100377    GDIP01076396    GDIP01051749    GDIP01049839    GDIP01043236    LRGB01000626    JAM51966.1    KZS17456.1    CH916375    EDV98182.1    KQ971358    EFA09226.1    GL445574    EFN89374.1    GDIP01253170    JAI70231.1    CH933808    EDW10605.1    GDIP01196730    JAJ26672.1    GBBI01000219    JAC18493.1    MTYJ01000013    OQV23244.1    GDIP01253413    JAI69988.1    JRES01001422    KNC23038.1    GDIP01110780    JAL92934.1    GDIP01137932    JAL65782.1    GDIP01253314    JAI70087.1    GDIP01139137    GDIP01131546    JAL64577.1    ACPB03004429    GDIP01194428    JAJ28974.1    KK107566    QOIP01000006    EZA48877.1    RLU21947.1    GDIP01015918    JAM87797.1    GDIP01136425    JAL67289.1    GL888493    EGI60151.1    AKCR02000001    PKK34158.1    GDIP01130188    JAL73526.1    CH902619    EDV35711.1    KPU75792.1    LSYS01008581    OPJ68407.1    GDIP01210021    JAJ13381.1    KL891806    KGL79173.1    KL672903    KFW87390.1    MUZQ01000018    OWK62965.1    ABQF01022872   
Pfam
PF00890   FAD_binding_2        + More
PF02910   Succ_DH_flav_C
Interpro
IPR003953   FAD-binding_2        + More
IPR015939   Fum_Rdtase/Succ_DH_flav-like_C       
IPR014006   Succ_Dhase_FrdA_Gneg       
IPR027477   Succ_DH/fumarate_Rdtase_cat_sf       
IPR037099   Fum_R/Succ_DH_flav-like_C_sf       
IPR011281   Succ_DH_flav_su_fwd       
IPR036188   FAD/NAD-bd_sf       
IPR003952   FRD_SDH_FAD_BS       
SUPFAM
SSF51905   SSF51905        + More
SSF46977   SSF46977       
SSF56425   SSF56425       
Gene 3D
PDB
2WQY     E-value=0,     Score=2377

Ontologies

Topology

Subcellular location
Mitochondrion inner membrane  
Length:
655
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0871899999999999
Exp number, first 60 AAs:
0.03039
Total prob of N-in:
0.00472
outside
1  -  655
 
 

Population Genetic Test Statistics

Pi
206.887721
Theta
172.53391
Tajima's D
1.180786
CLR
0.095668
CSRT
0.713064346782661
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 LGANSLLDIVVFGR 100.00 1e-10
26822097 GCGPEKDHVHIQIHHIPPEQIK 95.24 5e-10
28467696 EPIPEAYFPK 95.24 5e-10
26822097 GSDWIGDQDAIHYMTK 100.00 6e-08
26280517 SWGEQGYYR 100.00 6e-08
25044914 SYFPIQFR 100.00 6e-08
28467696 SYFPIQFR 100.00 6e-08
28556443 SLLDIVVFGR 100.00 7e-06
28556443 PGDPQPPLAPTTGEASIANLDSIR 100.00 6e-04
28556443 GEGGFLVNSK 100.00 0.002
28556443 HDALVIGAGGAGLR 100.00 0.002
28556443 LGANSLLDIVVFGR 100.00 0.008
28556443 KHTLAETDPATGDTR 100.00 0.008
28556443 KHTLAETDPATGDTR 100.00 0.008
28556443 AMTVEIMEGR 100.00 0.008
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号