SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01343
Annotation
PREDICTED:_uncharacterized_protein_LOC105384490_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.247
 

Sequence

CDS
ATGTCAGAAGAAAAACCTGAATTGATGGTTATGACGCAGGAGCAATTCACGACACTCATTAACAAGTTGTCAATTACAAACGAAGGTAGCCAACACAAAAGCAGTTTCGCTCGTTGCACAAAAAGGTACGACGGAGAAAGAAATCATAATAAAGTGGAAGAGTTTATCACAAATATTACTATCTACAAGAAAATTGAAAAAATCACCGACGAAGACGCTCTCGAAGGATTAACGTTGTTACTAACAGGACAAGCAGCTACGTGGTGGAGTGGCGTCAAAGGTGAGATAAAAAAGTGGAATCAAGCTTTAGACGCGATCAGAAGTGCATTTGCCCCAAAAATGCAACCGCATGAAGTTTATCTGGAATTGTTTGCGAAGAAGCAAACAAACGAAACTATTGATGCATTCGTTTGTGACAAACGTGCCTTGCTATCGCATCTTCCAGCAAAAAGGCACAAGGAAGAAGAGGAACTGGATTTCGTATACGGACTCCTCAATATCCGCTTCAAAAAAGAAATTCCTCGCTATGAGATCAAATCGTTCTCAGAGCTATTGGAACGAGGTCGACATATTGAAAACCTTGCCAAAGAAGCCGAAGAAATTGCAGAAACTAGCCTGCGCACGGGTATTGAGAGGAAGCAGCCGAAAAGATGTTCGTACTGTGGCAAGAAAGGCCATCTTCAAGAAGTTTGCCGTAAAAGATTGTCAGAGGAAGCAATGGGAAAAAATATGTCCTCAAGCGAAATTGTACAGATAAGCTGTTATGGTTGTGGAGCACCGGGGGTATTTCGCAGCAACTGCAAAACGTGTAAAAACAATGAAACGCCGCCAAAACCAGTTTCATTTTACGCACTACAAACTACCATTAATAATGCCAAAATACCAACCATTGAAATCAACGTGAAAGGCGAACATGGCTACGCACACATTGATACCGCAGCTAAAACTAGTATGGCAGGTACACATTTGTACAAGACACTAGTATGTCAAGGTACTAAATTTGACGAAAAGCCAGCTGACGTCATCCTCGCTGATGGTACCAAACGAATAACGAAGCTACTAACTGCTAAAGTGGATGTTGTGGTAGGAGGACGACTTTTACCTATCACATTTTCTGCAATGCCAGAAGCAGAAGACAACAGAACCCTGCTTGGTATAGATTTCTTGGAGAAGTTTGGAATTGTTCTAAATTTACCCCAACGAGTGTGGTACTTCTTGGATGATCCAAAACAAAAATTTCAGTTTATAAGATTGTCAAGCGACATAGTTCCGTTAAAGGCAGCTAGATCGCTGACCTTTAATGAGAGACCTTGCAAGATTGACAACGGTGAAGCGGGTTTGAGTGATTTCCTAAAATACGCTAAGGAGTTAAAGATGCTTTCACCAATGAAAAATACTCCTTCACCACTTCACAGCGAACATGGTGATATCAGTCCCATCCCAACCAAGAAAGCCCGTTATGCATTGGTAAAATTGGACACACCGCCACGACCAGTGCGACCACGTGAACCAGCCGATGCAGCATCTTGTGTTGATCCTCGCATTACTTATTTACCAATAAATCCTATAAACATGTATTCTTTGGACATTTATTTGAAACCTCACGAAGGCTCTGTGTTCACAAATGAAGAACGAGTAGTATTCAATGATCTACTTCATGAATATAGGGACATATTCAATAAAAACGGAAATCCCACACCGTTCGCAGTACATAGAATAGACACGGGAACACATCCGCCTATTAGTGTTAAGCCCTACAGATTGTCACCAGCTCGACAAACACAACTTAGGGAAAAACTTGATGAAATGATTAGTAATGATATAATCGAAGAGAGTGATTCACCATGGGCAGCACCCGTTATTCTAGTACCAAAAGGGGATAACGACGTTCGAGTTTGCATAGACTATAGAAAACTAAATGAAATCACAAAACCAGATAGGTATCCATTACCACGTATTGATGACCTGCTTCATCAAGCAAAGGGGTTGCCATATATGTCTACACTCGACTTACAATCAGGATACTATCAAATAGTGGTAAATCCAGACGATCAAGACAAAACAAGCTTTATATCACCGTTTGGAAACTTTCGTTTTAAAAGAATGCCATTTGGATTACGAAATGCTCCAGCAACTTTTCAAAGGCTAATGGATAAATTTATACAAGGCTTAAAGACAAAGTACACACTAGCATACTTAGATGATTGCATAACAAGAGCATACTCCTTTAAAGAGCATGTAGAGAATCTGCGAGAAATATTTAATAAGCTACGTGAGTATAATCTCAGAGCTAACAGAAACAAATGTAAATTCGGGTGCACAGAAATAAAATACCTAGGACATATTATTGTACCTGAGGGAATAAAGTCTGACCCAGAAAAGGTATCAGCAATTATGAAACTCAACAAACCCAAAACAATGAAACAATTAATGTCGTTTCTCCAAACTGCGTCATGGTATCGAAGATTCATAAGAAATTTTGCACAAATTGCACAACCTTTAACCAATCTAACAAAGAAGAAAGTAAGTTGGAAATGGGAGTCAAAACAACAAGAAGCTTTCGACAAATTAAAGCTCGCTTTGACGACTGCCCCAGTCTTAAGACAAGCTAACACTAATTTACCTTTCACAATTAAAACAGATGCAAGCCAGTATGCTATAGGAGCAGCTTTAGTGCAGGGGGAGGGAGAAGAAGAACACCCAGTAGAATACGCAAGTAGACTCCTGAATACAGCTGAATGCAATTACACTGTAACTGAGAAAGAAGCATTAGCCATAGTTTGGGCTATTTCAAAGTTCCGAGGATACATAGAAGGAACAAAATTTGTGACTATAACAGATCACCAACCGCTGAAGTGGTTAATGAACCTAAAAACTCCAACGGGTCGTCTACCACGTTGGGCACTCCAGTTACAACCCTATGATTTCCAAATTAAGTATTCTCCAGGACGAACTAATGTCGTGGCCGACACACTATCTCGACCACCATGTCAGGATCATGATGAAGATTGTACCATTTGTCGTATAGATCTCGAGATGCCGAAACCTAATGAAAAACATTTAACAGACGAACAATTAAAAGATGAAGTTCTAAAAAATATAATTGAAACTTTAGAAGAAGGAGGACATTCCATAAACTATGCTGAATATGTTAAAAAAGGATATATACTACATAAAGGTGTTTTGTATCTTTACACTCCAGAACAAGACGACGAAAATGCAAAATTAGTAGTCCCTTCTCACGAAATAACTAACGTCCTTAAAGCGTTTCACGATTCACACACTGCTGGACATATGGGAGCAGAAAGAACTCTTCAGCGAATCATAAATAAATTTTATTGGAAAGGGCAACGAAAAGATGTCATAAAATACGTGAAAACGTGTGAAGAATGTCAGAAATATAAACCTTCAAATCAGAAACCAGCAGGTTTATATCAATCTACTCCAAATACCCAGAGGTTTGAAGTATTATCAGTAGACTTGTTTGGTCCGTTACCAAAAGGCCTTTCTGGTGAAAAATGGATATTTATAATAGAAGACATGGCTTCACGATGGGTTGAAATGTTTCCGTTGAGAGAAGCTACAGGTGAAAGCTGCGCTTTGATTTTGCTAAATGAAATATTTCTCCGATACGGATTACCACGAAAAATTGTTTGTGATAATGGAGTACAGTTTATATCGGCAGTAATGCAAAAACTTACATACTGCTTAGAAATCCAACAAGTTTTCACTCCAGTATATCATCCTGAACCAAATGTAGTTGAAAGAAAGAATAGAGACATGAAAACACAAATAGCTATAATGGTTAAAGACAAACACAATTTGTGGCCGTCAACACTTCCAGCTATACGATTTGCAATGAATACAGCTCGTTGTCGATCTACATGCTTTTCACCAGCCTACTTAACGTTTGGAAGAGAATTACGGACACCGTACGAATTGACTCATGACCTTAGTTCGATAGTAGCATCTGAAAATTTTCTGGCAGAAATCACACCTAAGCTAAAACAACTAGCCCAGGATTTGAAACTAGCAAGAGAAAATGCAGAGATCAACATGGATGAAGCTTGTCATAAATCAAATAATAAGAGAAGACCAGACCCAGGACATAAAGTTGGAGACCTAGTCTTAATAGAATCCCATCCTATTAGTAATCTTAACAAGCAATTTTCTGCCAAATTTGCACCAAAGCAAGATGGTCCTTATGTGATAATGAAGAAACACGGTACTTCTACCTATGATGTTGCACACCCAGATTCACCAGATATATCAATTGGGAAATACCACTCCTCTGCAATGACAAAATTTGAGAAGAGAGCTGATAGCATAGTTCAGCCGACTTATCCAATACGTCGTCGAGGACGACCACTGATGGTTTGGTGGGGTATTAGCTATGAAGGAGTGACCGAGCCATACTTTTGTGAAAAAGGTATCAAAACATCGGCACAAGTATATCAAGATACCATTCTTGAGAGGGTAGTGAGGCCCCTTAACAACACCATGTTCAATAATCAAGAATGGTCCTTCCAGCAAGACTCGGCGCCAGGTCATAAAGCTCGGTCTACGCAGTCTTGGTTGGAAACAAACGTTTCGGACTTCATCAGAGCTGATGAAGACTGGCCGTCGTCTAGTCCCGATCTTAATCCGCTGGATTATGATTTATGGTCAGTTTTAGAGAGTACGGCTTACTCTAAACGCCATGATAATTTAGAGTCCCTAAAACAATCCGTACGATTGGCAGTTAAAAAATTTCCCATGGAAAGAGTGCGTGCTTCTATTGATAACTGGCCTCAACGTTTGAAGGACTGCATTGCAGCCAATGGAGACCACTTCAAATAA
Protein
MSEEKPELMVMTQEQFTTLINKLSITNEGSQHKSSFARCTKRYDGERNHNKVEEFITNITIYKKIEKITDEDALEGLTLLLTGQAATWWSGVKGEIKKWNQALDAIRSAFAPKMQPHEVYLELFAKKQTNETIDAFVCDKRALLSHLPAKRHKEEEELDFVYGLLNIRFKKEIPRYEIKSFSELLERGRHIENLAKEAEEIAETSLRTGIERKQPKRCSYCGKKGHLQEVCRKRLSEEAMGKNMSSSEIVQISCYGCGAPGVFRSNCKTCKNNETPPKPVSFYALQTTINNAKIPTIEINVKGEHGYAHIDTAAKTSMAGTHLYKTLVCQGTKFDEKPADVILADGTKRITKLLTAKVDVVVGGRLLPITFSAMPEAEDNRTLLGIDFLEKFGIVLNLPQRVWYFLDDPKQKFQFIRLSSDIVPLKAARSLTFNERPCKIDNGEAGLSDFLKYAKELKMLSPMKNTPSPLHSEHGDISPIPTKKARYALVKLDTPPRPVRPREPADAASCVDPRITYLPINPINMYSLDIYLKPHEGSVFTNEERVVFNDLLHEYRDIFNKNGNPTPFAVHRIDTGTHPPISVKPYRLSPARQTQLREKLDEMISNDIIEESDSPWAAPVILVPKGDNDVRVCIDYRKLNEITKPDRYPLPRIDDLLHQAKGLPYMSTLDLQSGYYQIVVNPDDQDKTSFISPFGNFRFKRMPFGLRNAPATFQRLMDKFIQGLKTKYTLAYLDDCITRAYSFKEHVENLREIFNKLREYNLRANRNKCKFGCTEIKYLGHIIVPEGIKSDPEKVSAIMKLNKPKTMKQLMSFLQTASWYRRFIRNFAQIAQPLTNLTKKKVSWKWESKQQEAFDKLKLALTTAPVLRQANTNLPFTIKTDASQYAIGAALVQGEGEEEHPVEYASRLLNTAECNYTVTEKEALAIVWAISKFRGYIEGTKFVTITDHQPLKWLMNLKTPTGRLPRWALQLQPYDFQIKYSPGRTNVVADTLSRPPCQDHDEDCTICRIDLEMPKPNEKHLTDEQLKDEVLKNIIETLEEGGHSINYAEYVKKGYILHKGVLYLYTPEQDDENAKLVVPSHEITNVLKAFHDSHTAGHMGAERTLQRIINKFYWKGQRKDVIKYVKTCEECQKYKPSNQKPAGLYQSTPNTQRFEVLSVDLFGPLPKGLSGEKWIFIIEDMASRWVEMFPLREATGESCALILLNEIFLRYGLPRKIVCDNGVQFISAVMQKLTYCLEIQQVFTPVYHPEPNVVERKNRDMKTQIAIMVKDKHNLWPSTLPAIRFAMNTARCRSTCFSPAYLTFGRELRTPYELTHDLSSIVASENFLAEITPKLKQLAQDLKLARENAEINMDEACHKSNNKRRPDPGHKVGDLVLIESHPISNLNKQFSAKFAPKQDGPYVIMKKHGTSTYDVAHPDSPDISIGKYHSSAMTKFEKRADSIVQPTYPIRRRGRPLMVWWGISYEGVTEPYFCEKGIKTSAQVYQDTILERVVRPLNNTMFNNQEWSFQQDSAPGHKARSTQSWLETNVSDFIRADEDWPSSSPDLNPLDYDLWSVLESTAYSKRHDNLESLKQSVRLAVKKFPMERVRASIDNWPQRLKDCIAANGDHFK

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF03732   Retrotrans_gag
PF00665   rve
PF17917   RT_RNaseH
PF00078   RVT_1
PF17919   RT_RNaseH_2
Interpro
IPR041588   Integrase_H2C2        + More
IPR036397   RNaseH_sf       
IPR041373   RT_RNaseH       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR005162   Retrotrans_gag_dom       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
Gene 3D
PDB
4OL8     E-value=5.40229e-76,     Score=729

Ontologies

Topology

Length:
1612
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00661999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00028
outside
1  -  1612
 
 

Population Genetic Test Statistics

Pi
46.520129
Theta
55.58503
Tajima's D
0.656509
CLR
104.801192
CSRT
0.560521973901305
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号