SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01342
Annotation
endonuclease-reverse_transcriptase_[Blattella_germanica]
Location in the cell
Mitochondrial   Reliability : 2.742
 

Sequence

CDS
ATGATATGGGAATCTGAACAACAACCTGTCCAGTGGTATTCGGGGGTCATCTGCCCCATACACAAAAAAGGCAGCCGGAAGAAATGCAGTAACTACAGAGGAATTGCTTTACTACCTACAGCGTACAAAATACTGTCATACGTTTTACTAAGCAGGTTAGAGCCGTATTCAGAAAAAATCATTGGGGATTATCAGTGCGGCTTCAGACGTAATCGTAGTACAGTCGACCAAATCTTTACTCTGAAACAGTTAATGGAGAAAAGATGGGAGTATGCACAAAGTATTCATTCGCTCTTTGTTGATTTTGCTAAGGCCTACGACAGCATAGATAGACCGACTCTATATAGAATCCTCAAGCGCTTTAAAATCCCACAGAAACTTGTGAGAATGGTGGAGGTTGCTACTAGGGAAAGTAGAATGACGGTACGAGTTGGCGCTTCTCTCACTGATGAGTTTGACGTTGTGACTGGACTCAGGCAGGGGGACGCTCTGTCACCAATGCTGTTCAACCTGGCACTTGAACACGCCATACGGAAAGTGAACACACTAAGTGGCGGAGTGTGGCTCAACGGACAGCATAGGGTGATAGGATATACCGATGACCTCGCTCTACTTGGAGAAAGAAAGCAGCACGTTATAGACGCACTCAACTGCCTTCAACAAGAAGCCTCTCGGATTGGCCTTCGCGTGAGCCACGAGAAGACAGAATATCTTCACATGCGTCGATATAAAAACATAAGACGGAAGCGAGAAGACCTAGTGGTGGGAAATACGAGGTTCAAAGGAGTGGCTAAATTCCGGTACCTTGGCTGCACTGTAACAGACACCAATGACAGGGAAGATGAAATCGAAATTCGTATACAAAATACCCTACGATGCAGTGCAGCCCTACACCCGGTTCTCTCTTCGAAGCTACTAAGCAGGCGCACCAAGATTCGGATATACAAGACTCTAGTCAGACCGATCCTATTGTATGGATGCGAAGCATGGACGCTCACACAGAAAGAAGAGGCAAAACTTCTCGTGACGGAGCGAAAGGTATTGAGAAAAATACTAGGACCAGTTCGGAAAGAAGACGGTTCTTGGCACGTCCGGAAAAATAAGGATGTGGAGAGGCTTTTTGGTGAGCCAAATATTCTGGGGGAGATGAAGGCACGGAGGCTCGGATGGCTCGGACATGTAGTACGTATGGAGCAGGATCGGGCTGTGAAACGGGTGTACACGGGTGTACCGGAGGGACGCCGCCCCGTAGGGAGGCCCAAGTACCGCTGGTGTGACGCTGTGGAAGGAAATTTACGGGAGCTCCAAGTGTCGGACTGGCAAGGTGTTGCGCAGCGCCGGGATGAATGGCAAAGTTTATTGTCGGAGGCCAAGACCCACTTCGGGGTCATAGCGCCAGCTCAGTAG
Protein
MIWESEQQPVQWYSGVICPIHKKGSRKKCSNYRGIALLPTAYKILSYVLLSRLEPYSEKIIGDYQCGFRRNRSTVDQIFTLKQLMEKRWEYAQSIHSLFVDFAKAYDSIDRPTLYRILKRFKIPQKLVRMVEVATRESRMTVRVGASLTDEFDVVTGLRQGDALSPMLFNLALEHAIRKVNTLSGGVWLNGQHRVIGYTDDLALLGERKQHVIDALNCLQQEASRIGLRVSHEKTEYLHMRRYKNIRRKREDLVVGNTRFKGVAKFRYLGCTVTDTNDREDEIEIRIQNTLRCSAALHPVLSSKLLSRRTKIRIYKTLVRPILLYGCEAWTLTQKEEAKLLVTERKVLRKILGPVRKEDGSWHVRKNKDVERLFGEPNILGEMKARRLGWLGHVVRMEQDRAVKRVYTGVPEGRRPVGRPKYRWCDAVEGNLRELQVSDWQGVAQRRDEWQSLLSEAKTHFGVIAPAQ

Summary

EMBL
PYGN01000510    PSN45119.1    PYGN01000451    PSN46127.1    PYGN01000064    PSN55609.1    + More
PYGN01000047    PSN56294.1    HE799691    CCH14900.1    PYGN01000203    PSN51319.1    PYGN01001382    PSN35227.1    PYGN01000020    PSN57453.1    PYGN01000324    PSN48495.1    PYGN01000070    PSN55417.1    PYGN01000219    PSN50892.1    PYGN01000502    PSN45243.1    PYGN01001004    PSN38555.1    PYGN01000580    PSN43876.1    AJVK01001578    PYGN01000078    PSN55011.1    PYGN01001494    PSN34463.1    PYGN01000082    PSN54842.1    PYGN01000613    PSN43351.1    PYGN01000629    PSN43121.1    GGMR01006433    MBY19052.1    PYGN01000287    PSN49259.1    GDAI01000742    JAI16861.1    GGMR01000126    MBY12745.1    GBBI01004263    JAC14449.1    GGMR01016675    MBY29294.1    GGMR01014652    MBY27271.1    PYGN01000119    PSN53667.1    GBRD01000202    JAG65619.1    GGMR01011466    MBY24085.1    GGMR01000301    MBY12920.1    PYGN01003402    PSN29545.1    GGFK01003183    MBW36504.1    PYGN01000107    PSN54137.1    GDHC01021627    JAP97001.1    FJ265555    ADI61823.1    GBBI01004198    JAC14514.1    GGFK01002192    MBW35513.1    GECU01011157    JAS96549.1    ABLF02027703    ABLF02061609    GGFK01002196    MBW35517.1    GBBI01004199    JAC14513.1    PYGN01000372    PSN47498.1    QOUI01000020    RCK67885.1    GBRD01017846    JAG47981.1    ABLF02026145    ABLF02026146    ABLF02042729    GBBI01004261    JAC14451.1    LBMM01005351    KMQ91586.1    KU311054    ALX81665.1    GGFL01003846    MBW68024.1    GBGD01000331    JAC88558.1    GGFK01001949    MBW35270.1    GGFK01005184    MBW38505.1    GGFJ01005240    MBW54381.1    GBRD01011073    JAG54751.1    GGFK01001798    MBW35119.1    GGFK01003613    MBW36934.1    GGFL01003845    MBW68023.1    ABLF02039015    QOIP01000009    RLU18885.1    ABLF02066124    ABLF02009557    ABLF02016497    ABLF02041313    ABLF02041567    ABLF02062088    GGMR01020071    MBY32690.1    GECL01002632    JAP03492.1    ABLF02019049    ABLF02067155    GGMR01010991    MBY23610.1    CH902961    KPU72636.1    IAAA01017079    LAA06070.1    ABLF02033384    NEVH01019065    PNF23216.1    CH902619    KPU76535.1    PYGN01000254    PSN50032.1    ABLF02003877    ABLF02042991    CH905131    KPU81852.1    GECL01001585    JAP04539.1    CH902653    KPU74858.1    PYGN01001465    PSN34679.1    ABLF02036907    ABLF02036915    ABLF02036922    ABLF02041419    GBBI01004262    JAC14450.1    CH902621    KPU81727.1    CH902657    KPU75308.1    CH904714    KPU81814.1    CH902626    KPU79149.1    ABLF02019047    AZNE01000717    KID80942.1    GGMR01001794    MBY14413.1    ABLF02013530    ABLF02013531    ABLF02013532    ABLF02043861    ABLF02057183    ABLF02067179    GALA01001775    JAA93077.1    NEVH01016288    PNF26362.1    GBHO01037470    JAG06134.1    ABLF02010115    ABLF02030763    GECU01026439    JAS81267.1    PYGN01000212    PSN51056.1    GBHO01037471    GBRD01009355    GBRD01009354    GDHC01014856    GDHC01007898    JAG06133.1    JAG56469.1    JAQ03773.1    JAQ10731.1    ABLF02018097    ABLF02043469    ABLF02056908    RAPH01000016    RNL65702.1    GAPW01000107    JAC13491.1    PYGN01000577    PSN43959.1    GAPW01000199    JAC13399.1    ABLF02020712    ABLF02020717    ABLF02054820   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR008906   HATC_C_dom       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
468
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.06433
Exp number, first 60 AAs:
2.06291
Total prob of N-in:
0.10182
outside
1  -  468
 
 

Population Genetic Test Statistics

Pi
409.560084
Theta
202.84177
Tajima's D
3.11989
CLR
0.218022
CSRT
0.984600769961502
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号