SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01306
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.619 Nuclear   Reliability : 2.284
 

Sequence

CDS
ATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCAGCATTCGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGTACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAACTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCGCAACCGGGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCCCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTATACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAATATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGAATTGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATACCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCAAAGCAAACTGTCCCTTCGCAATAAGGTAACTCTCTACAAAACTTGCATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCCACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCATGGTTCCTTAGGAATGTGGATCTCCACGATGACCTGGAGCTCGACTCTCTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGTAAACCGTCGACGTCGCCCAAAGCACATCATTACGGATCCTCCTGATCCATTAACGGTGCTATTAGGCACCACAAGCACCGGTCACCGTCCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGGCGAGCGAACTAA
Protein
MPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRTSLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIRNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLPTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRNMSLLHRRLQIAVATMGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSQSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTHLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSLSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMVNRRRRPKHIITDPPDPLTVLLGTTSTGHRPRRTRRLRRRARRAN

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459265    KPJ02064.1    KQ459259    KPJ02068.1    AF081103    AAC72921.1    AF081101    AAC72919.1    GEZM01008457    JAV94772.1    GALX01005359    JAB63107.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GGMR01019198    MBY31817.1    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02003961    ABLF02059872    KK117880    KFM71667.1    ABLF02033757    GBBI01004571    JAC14141.1    ABLF02008933    GGMR01018716    MBY31335.1    ABLF02042518    ABLF02057746    GGMS01012005    MBY81208.1    GFTR01008038    JAW08388.1    GGMS01008766    MBY77969.1    GGMS01000737    MBY69940.1    GBBI01004395    JAC14317.1    NEVH01023962    PNF17612.1    NEVH01007443    PNF35684.1    NEVH01003017    PNF40781.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01020071    PNF21969.1    RPOV01000134    RPJ78669.1    NEVH01010546    PNF32261.1    GGMS01002992    MBY72195.1    GGMS01004685    MBY73888.1    NEVH01000280    PNF43672.1    NEVH01005938    PNF38077.1    GEZM01038405    JAV81653.1    GGMS01017914    MBY87117.1    NEVH01023961    PNF17613.1    ABLF02024246    NEVH01001355    PNF42855.1    GGMR01016114    MBY28733.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01019964    PNF22161.1    NEVH01017559    PNF23833.1    S59870    AAB26437.2    NEVH01014858    PNF27387.1    GGMR01004661    MBY17280.1    GGMR01003407    MBY16026.1    NEVH01006754    PNF36554.1    NEVH01011985    PNF31054.1    NEVH01002716    PNF41415.1    NEVH01007838    PNF34986.1    GGFJ01002256    MBW51397.1    GFXV01007093    MBW18898.1    NEVH01019376    PNF22596.1    GGMS01006359    MBY75562.1    NWSH01000032    PCG80497.1    GGFJ01002257    MBW51398.1    LBMM01010106    KMQ87671.1    NEVH01006721    PNF37225.1    NEVH01019080    PNF22876.1    GGFJ01001842    MBW50983.1    NEVH01027074    PNF13841.1    GGMR01000676    MBY13295.1    JRES01000644    KNC29657.1    NEVH01009134    PNF33528.1    GGFJ01001843    MBW50984.1    GGFJ01001844    MBW50985.1    NEVH01021205    PNF19912.1    NEVH01026154    PNF14491.1    JXUM01014072    KQ560393    KXJ82651.1    GBBI01001646    JAC17066.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02055645    JXUM01155316    KQ572171    KXJ68070.1    NEVH01012089    PNF30491.1    NEVH01007393    PNF35987.1    NEVH01006736    PNF36716.1    NEVH01026386    PNF14434.1    GEZM01053022    JAV74219.1    ABLF02008463    NEVH01007578    PNF35646.1    PYGN01000192    PSN51582.1    GEZM01074951    JAV64378.1    LBMM01014395    KMQ85192.1    GBGD01000880    JAC88009.1    GGFJ01001858    MBW50999.1    ABLF02034467    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.000505924,     Score=104

Ontologies

Topology

Length:
579
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.98791
Exp number, first 60 AAs:
0
Total prob of N-in:
0.06157
outside
1  -  579
 
 

Population Genetic Test Statistics

Pi
0.842193
Theta
0.481972
Tajima's D
0.529161
CLR
0
CSRT
0.617969101544923
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号