SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01282
Annotation
AF461149_1_transposase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.052 Mitochondrial   Reliability : 1.599
 

Sequence

CDS
ATGATAAGGTGTACGCACACAGTAGTGAAGAAGCGAGCAACCTTATTCCGCGTGTCCAACGAGGTCATTTTCCATCCTCGCTCATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTGAGAAAGGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTCCTGACGAACCTTGTGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCAGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MIRCTHTVVKKRATLFRVSNEVIFHPRSWLGVSYWGLTEVHFCEKGVKTNAVVYQNTVLTNLVEPVSHTMFNNRHWVFQQDSAPAHRAKSTQDWQAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKACIQNHGGHFE

Summary

Similarity
Belongs to the TGF-beta family.
EMBL
AF461149    AAN06610.1    AB363028    BAG15927.1    AB473770    BAH20555.1    + More
AB363006    AB363010    AB363014    BAG15923.1    BAG15924.1    AB363018    BAG15926.1    RSAL01000084    RVE48403.1    RSAL01000114    RVE46946.1    RSAL01000012    RVE53510.1    RSAL01000174    RVE45058.1    RSAL01000392    RVE41996.1    RSAL01001770    RVE40705.1    RSAL01000209    RVE44259.1    RSAL01000149    RVE45804.1    RSAL01000470    RVE41612.1    U47917    AAB47739.1    JF779677    AEO90418.1    LNIX01000030    OXA41211.1    RSAL01000189    RVE44738.1    JARK01001411    EYC06502.1    JOJR01000583    RCN36166.1    DS268420    EFO87874.1    PDUG01000005    PIC23776.1    JOJR01000015    RCN51257.1    UZAH01026445    VDO80847.1    DS268747    EFP00909.1    DS268433    EFO97645.1    PDUG01000012    PIC13506.1    DS268612    EFO94085.1    JARK01001601    EYB87313.1    CAVP010058755    CDL95145.1    KN728435    KIH63782.1    UYSL01022144    VDL79905.1    CAVP010059404    CDL95787.1    UYSL01019905    VDL71189.1    JARK01001418    EYC05389.1    JARK01001337    EYC34439.1    UZAH01001595    VDO19836.1    UZAH01000669    VDO19161.1    DS268565    EFO90304.1    PIC29926.1    PDUG01000001    PIC51673.1    JARK01000059    EYC44525.1    JARK01001658    EYB84158.1    DS268492    EFP11674.1    JARK01001345    EYC27589.1    UZAH01031030    VDP13493.1    UYSL01009772    VDL68385.1    DS268428    EFO94379.1    EFP11689.1    DS268508    EFO83264.1    DS268466    EFP06959.1    DS268606    EFO93488.1    DS268673    EFO98001.1    DS268539    EFO88027.1    DS268525    EFO85497.1    DS268679    EFO98285.1    DS268421    EFO88618.1    PDUG01000006    PIC20538.1    HE601413    CAS00486.1    JARK01000176    EYC41234.1    KN769991    KIH46151.1    UZAH01025744    VDO69727.1    DS268545    EFO88382.1    UYSL01021399    VDL78127.1   
Pfam
PF00431   CUB        + More
PF00019   TGF_beta
PF07992   Pyr_redox_2
PF13358   DDE_3
PF00292   PAX
Interpro
IPR009057   Homeobox-like_sf        + More
IPR000859   CUB_dom       
IPR035914   Sperma_CUB_dom_sf       
IPR001839   TGF-b_C       
IPR029034   Cystine-knot_cytokine       
IPR017948   TGFb_CS       
IPR015615   TGF-beta-rel       
IPR036188   FAD/NAD-bd_sf       
IPR023753   FAD/NAD-binding_dom       
IPR036259   MFS_trans_sf       
IPR038717   Tc1-like_DDE_dom       
IPR001523   Paired_dom       
IPR036388   WH-like_DNA-bd_sf       
SUPFAM
SSF46689   SSF46689        + More
SSF49854   SSF49854       
SSF57501   SSF57501       
SSF51905   SSF51905       
SSF103473   SSF103473       
PDB
5CR4     E-value=4.93161e-08,     Score=133

Ontologies

Topology

Subcellular location
Secreted  
Length:
180
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04833
Exp number, first 60 AAs:
0.04587
Total prob of N-in:
0.40991
outside
1  -  180
 
 

Population Genetic Test Statistics

Pi
84.072086
Theta
77.127059
Tajima's D
0.281675
CLR
0
CSRT
0.455277236138193
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号