SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01253
Pre Gene Modal
BGIBMGA007548
Annotation
PREDICTED:_uncharacterized_protein_LOC107191251_[Dufourea_novaeangliae]
Location in the cell
Nuclear   Reliability : 3.879
 

Sequence

CDS
ATGATGAAGCACATGTCCGATCGTATGGCAGCAATACCGGACGCAAAAGTTAAAATCAATGACGTGTTTTTACCATCATACGATCCGGACGCAAATATAGGAGTGCGAGAGTGGTGTAAGCATGTGACCACGGCCATGGAAACCTACAACCTGAGCGATTATGATGTCAGAATGAAAGTCGGTAGTTTGCTCAAAGGTCGTGCAAGGTTGTGGGTTGACAACTGGCTTATCTCAACCTCCACGTGGCAGGAATTGCGTGATGTTATGATAACAACCTTTGAACCTGAAAATAGGTATTCTCGTGATATAGTTCGTTTTCGGGAACATAGTTACGATAATTCAAAGGACATCACGCAGTTCTTATCACAGGCTTGGATGTTATGGAGACGTGTCACTAAGGATAAATTATCGGATGATGACGCGGTTGAGGCTGTGATTGGTTGCATTGGAGATGAGCGATTGAGAATCGAGTTGTTAAACGCCAGGGCTACTTCGGTACCAGAGTTGATTTCTGTAGCTTCCTCAATAAAGCGCAGTAAGCGACCTTATCCTGGTTCATCAAATATGCAACAGGGCCCTGTCAAACGACAACGATTCTCGGATAAGCCGTCTTTATATTGTCAACAGTGTAAAAAGCCCGGTCATGATACTCGAGATTGCCGTTACCGTGATAAAGCTGATAACCCTCAACTGCGACATCATGATGATAAAACCGTTCCTCAAAGGGATAATAAACCGACCTGTACGTTCTGTTCACGAACAGGTCACACATATGAAACTTGTTATAAACGTGAACGAGCAATTGTCTCGAATGTTAATTGCGTAGGTGCACCTAAATTAAACTCCATACCGGTGTTGATTGGAGGTTTAAAATTTTTCGGGATTTTTGATAGCGGGGCGGAATGTTCGGTAATACGCGAATCGGTTGCTTCAAAATTACCGGGTAAAAGGACGAATGTAGTTAATTATCTAAAGGGCTTAGGACAGTTTACAGTAGTGTCATTATCAACGTTGATAACCGTTTGTGTGATCGATGATATAAGGGTCGAACTTCATTTCCACATAGTCCCGGATTATGAAGTGTGTTCAGATATTTTAATAGGCATGAATCTTATGGAAAATACAAATTTAAGTGTGATAGTGAATTCAAAGGGCGTGGCATTGATTCATCAGCCCGCGATTTTCCACATGCGATTACAAAGCGAAAAGTTTGACAATTTGGATTGTGACTTGACGGATAGTGATCAAATAAACGAACTTAAGTTGCTATTAGCAAAATTTGAACATATTTTTATCCAGGGTTACCCTCACACGCGTGTTAATACCGGTGAACTCGAAATACGTCTGAAAGACCCCAACAAGTGTGTTGAGCGTAGGCCATATAGATTGAGTCCAATCGAACGACAAAAAGTTCGTGATATTGTGAGCGAGTTACTTGAACACAATATTATTCGAGAGAGCAAGTCACCTTTCTCCAGTCCGATAATATTAGTCAAAAAGAAAAACGGCAAAGATCGCATGTGCGTGGACTATCGCGAGCTGAATAGAAACACTCTTAGGGATCACTATCCTCTGCCTATAATTTCCGATCAAATAGACCAATTAGCGGGTGGTTATTACTTCTCTTCTTTTGATATGGCAGCAGGCTTTCATCAGATCCCCATTTCTAAAGGGTCTATTGAAAAGACTGCCTTCGTAACACCGGACGGCATGTACGAGTACTTGACCATGCCATTCGGTCTCAGTAATGCATGTTCCGTTTACCAGAGGTGCATGAATAGGGCTTTAGCTGACCTTCTAAATTCACCTGACCAGGTCTGTCAAGTGTACGTCGACGACGTACTAACAAAATGTTGTGAATTTACAGAAGGTTTGTCCCGTATCGAACGGGTACTTATCGCATTACAAGATGCCGGGTTTTCCATAAATATTGAGAAAACTGCCTTCTTTAAACGCTCTATCGAGTACTTGGGCAATATAGTTACAAACGGACAGGTTAGTCCTAGCCCAAAGAAAGTGGAGGCTTTAACGAAGGCACCTATTCCACGGACGGCTAAACAAGTAAGGCAATTCAATGGCCTCGCCGGATATTTTCGTCGTTTCATTCCCAATTTCTCGCGTGTGATGGTACCGCTTTATGAGCTAACAAAAAAAGACGCAAAATGGGAATGGAATGAAAGGCATGATGAGGCCAGAAATATAATCATACTGCATTTGTCTACTGCGCCTACCCTTGCATTATTTCAGGAAAACGCACCAGTTGAGCTTTACACAGATGCGAGCAGCCTCGGTTACGGCGCGGTACTGATTCAGATAATTGGAGGACGCCAGCATCCAGTCGCGTACATGAGCCAGCGTACCACTGACGCAGAGAGCCGCTACCATTCATATGAACTCGAGACGCTAGCAGTGGTGAGAGCAGTAAAACATTTTCGGCACTACCTATACGGCCGAAAATTCAAGATAATAACAGACTGTAACGCCTTGAAAGCATCTAAGCATAAGAAGGATTTACTGCCACGAATTCATCGCTGGTGGGCTTTTCTGCAGAACTACGAGTTCGAGGTCGAATATAGGAAAGGTGAGCGACTGCAGCACGCAGACTTTTTTAGCCGAAACCCTACAACTAAAATGGCGATCAACATCATGACCAAGGACGCAGAGTGGCTGCAAATTGAACAGCGTCGTGACGATACTCTTCGTCCTGTGATAAACAGCATGACAACCGACAACCCAACTCCCGGCTACGTTCTTGAGGAAGGCGTGCTGAAGAAATTACTCGCTGATCCTTCCATACTCGGTGCAATCCAGGCACAGCTCCATCCAATACAAAAACCTACTGCAGCGTTTCAAGTAGTCCACATAGACGTTACCGGAAAACTTGGTACGAGAAACTCTGAAGGTCAGGACGAATATGTGATAGTTATCATTGACGCCTTTACCAAATACATCCTACTTAGTTACTCTAACGACAAGAGTCAAAGCAGCAGTCTCGCAGCGCTGAAACGAGTCGTGCATTTGTTCGGGACCCCAGTCCAGGTAGTGGTTGATGGCGGCCGAGAATTTCTCGGCGAATTCAAAGCCTATTGCGACTGTTTTGGTATCAATTTACATGCTATAGCGCCAGGAGTAAGCCGAGCAAACGGGCAAGTGGAACGAATAATGAGTACCTTGAAAAATGCACTAACAATAATAAGAAATTATGACACTGAAAACTGGCAAACGGCCTTGGAAGCCCTTCAACTTGCATTTAATTGCACCCCACACAGAGTGACAGGGTGCGCGCCACTTACTCTCCTGACACGCCGTAAGCACACCGTTCCGCCAGAACTTTTAAGGTTGGTAGACATTGATAGCGAAACCGTCGATTTTGATATGCTCGATCAACACGTGCAACAGAAAATGGCGGCTGCAGCTGAATATGATAAGCATCGTTTTAACAGAAACAAAGCCAAGCTGCGTCCTTTTCAAAGAGGAGACTACGTCCTCATCAAAAACAACCCCAGAAATCAAACCAGCTTGGACCTGAAATACAGCGAGCCATACGAGATTTACAGAATAATGGACAATGACCGCTACATGGTAAAACGTGTGACCGGCAGAGGGCGCCCACGCAAGGTGGCGCACGATCAGCTGCGCCGGGCTCCACAGCCTGGGGAACAGGAAACCGTGTCGACGGGCGCCAACGATGACACCGAACAGCAGACCACAGCCCAAGTAGTCGATACACCGGATCCACCATCAACGTTATTAGACGCTTAA
Protein
MMKHMSDRMAAIPDAKVKINDVFLPSYDPDANIGVREWCKHVTTAMETYNLSDYDVRMKVGSLLKGRARLWVDNWLISTSTWQELRDVMITTFEPENRYSRDIVRFREHSYDNSKDITQFLSQAWMLWRRVTKDKLSDDDAVEAVIGCIGDERLRIELLNARATSVPELISVASSIKRSKRPYPGSSNMQQGPVKRQRFSDKPSLYCQQCKKPGHDTRDCRYRDKADNPQLRHHDDKTVPQRDNKPTCTFCSRTGHTYETCYKRERAIVSNVNCVGAPKLNSIPVLIGGLKFFGIFDSGAECSVIRESVASKLPGKRTNVVNYLKGLGQFTVVSLSTLITVCVIDDIRVELHFHIVPDYEVCSDILIGMNLMENTNLSVIVNSKGVALIHQPAIFHMRLQSEKFDNLDCDLTDSDQINELKLLLAKFEHIFIQGYPHTRVNTGELEIRLKDPNKCVERRPYRLSPIERQKVRDIVSELLEHNIIRESKSPFSSPIILVKKKNGKDRMCVDYRELNRNTLRDHYPLPIISDQIDQLAGGYYFSSFDMAAGFHQIPISKGSIEKTAFVTPDGMYEYLTMPFGLSNACSVYQRCMNRALADLLNSPDQVCQVYVDDVLTKCCEFTEGLSRIERVLIALQDAGFSINIEKTAFFKRSIEYLGNIVTNGQVSPSPKKVEALTKAPIPRTAKQVRQFNGLAGYFRRFIPNFSRVMVPLYELTKKDAKWEWNERHDEARNIIILHLSTAPTLALFQENAPVELYTDASSLGYGAVLIQIIGGRQHPVAYMSQRTTDAESRYHSYELETLAVVRAVKHFRHYLYGRKFKIITDCNALKASKHKKDLLPRIHRWWAFLQNYEFEVEYRKGERLQHADFFSRNPTTKMAINIMTKDAEWLQIEQRRDDTLRPVINSMTTDNPTPGYVLEEGVLKKLLADPSILGAIQAQLHPIQKPTAAFQVVHIDVTGKLGTRNSEGQDEYVIVIIDAFTKYILLSYSNDKSQSSSLAALKRVVHLFGTPVQVVVDGGREFLGEFKAYCDCFGINLHAIAPGVSRANGQVERIMSTLKNALTIIRNYDTENWQTALEALQLAFNCTPHRVTGCAPLTLLTRRKHTVPPELLRLVDIDSETVDFDMLDQHVQQKMAAAAEYDKHRFNRNKAKLRPFQRGDYVLIKNNPRNQTSLDLKYSEPYEIYRIMDNDRYMVKRVTGRGRPRKVAHDQLRRAPQPGEQETVSTGANDDTEQQTTAQVVDTPDPPSTLLDA

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00665   rve
PF00098   zf-CCHC
PF00078   RVT_1
PF17917   RT_RNaseH
PF00077   RVP
PF09668   Asp_protease
PF02037   SAP
PF03732   Retrotrans_gag
Interpro
IPR041577   RT_RNaseH_2        + More
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR018061   Retropepsins       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR036361   SAP_dom_sf       
IPR003034   SAP_dom       
IPR005162   Retrotrans_gag_dom       
IPR034145   RP_RTVL-H-like       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
SSF68906   SSF68906       
Gene 3D
PDB
4OL8     E-value=9.95193e-70,     Score=674

Ontologies

Topology

Length:
1253
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.26688
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01189
outside
1  -  1253
 
 

Population Genetic Test Statistics

Pi
33.917726
Theta
215.763695
Tajima's D
-1.72349
CLR
1362.583872
CSRT
0.0356482175891205
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号