SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01250
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.089
 

Sequence

CDS
ATGGAAGAAGAACTTTTAGGGTTTCTCGGGTTACTTGCCGAGAAGTACCCGGTGTTATCAAACCTCACGGCCGAATTCGCGGCCTACAGGGCCGCCCGCGCGAGTCCCGCCCCGCCCGCGTCCCTCGCCGCGTCATTTCGAGCCGCGCAGTCATGCCCCGCCCCCAAACCCAATTTGAGCGCACGTACGCACGTAGCGACTCACGAAGCGCCTAGCGCCAACGAAGCGCCTAACGCACCCGCGACGTCATTCTCGCCAATATCATCCGTCGCGTCGTCCGTAATAAATAACTCAGGTTCAGACTCCGATACCGGATCGGAGATGGACTTCGAGTCCGCGACGAGCCCGCAGCCCGGAACCTCGGATGGGTTCCAAACGGTAAAACGCGGGAAAAAACGTACTCGCGCCGTGGAGTCCCGGAGCTCCACGACAAAACAAACCAAGTCAGCGACTGCCTCCCGTCCGCAGGTAGTCGTGACACCGGAGTCGGACTCCGGCCGCCGCGCAACCCCACCGCCGCGTCCCAAGCCCGCATCCGCGCAAAAAACCGTCGCCCCGCCCCCGCTGATTCTCCAGGAGAAGTCAGCGTGGAACCGCGTCTCCCAGGCCCTTCAGGCAAACAAAATAAATTATACCCATGCGCGTAACGTCGCGCATGGGATTCAGATAAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCAGCATACCTCCGAAAGGAGAACATAGGTTTCCACACCTATGCTCTTCAGGAGGACCGTGAGCTCCGCGTAGTAATACGCGGAGTTCCGAAGGAACTCGACATAGAGTATGTAAGGGAGGATCTGACCGCTCAGTCCCTCCCGATAGTAAGTGTGCACCGGATGCACAACGGCCGCGACAAAAAACCATATAACATGGTTCTAGTCGCTCTAGAACCAACCCCGGAGGCCAAGAAAAAGATCGCATGTCTCGCGACAGTATGTGGCCTATCCGGGGTTACCATTGAAGCCCCCCATAGACGTGGCACTCCCGGACAGTGCCACAGATGCCAACTATATGGCCACTCGGCTCGGAATTGCCACGCGCGCCCCCGCTGCGTGAAGTGTCTCGGCGATCACGCCACGGTAGATTGCTCGCGAGTTAGGGAAACCGCGACCGAACCTCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAATTACCGTGGATGTCCTAGGGCTCCGCGAAAACGTCCGACCCACCCAGCCCCCCGTACCGTCGGCCCAAAGACTTCGGTGCCTTCAGCACCGAAACCCGCCTTCGTACCGGCGGCGGTTCCCACCGTCTCGGCGTGGAATAAACCGCTGCCGTATACGAGGTCGGGAACACAAACCGCACCCCAGCCCCCGCTCGCGACACGTCCCGCGCCGCAGCCCCTGCTCGCACCTCCCCCCGCGCCCGCGTACCGTCCCCCGCAACCCTCAGCCGTCAACGACTTCACGCTCGTGCGCGACTTCGTCACGGCGGTCAACTTCGACCGTCTGCGATCGTTCGCAGACGCGTTGCGAAGGGCGGTAAACCCCGAACAACGGCTCGCGGCCGCGTTCGACTACATGGACGTTTACGAGTCCGTGGCCCCATTCTACAATGCTAACGGACTCGCGCGACAACGCGATCAAATTTACGAATTCCTCCGCGACAATCTTGTAGATATTCTGCTAGTGCAGGAGACCTGCCTGAAGCCCTCGCGTCGTGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACCCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTCTATCTCCCCCCGGACAAGCCCCTTCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCACAGTTCAAACATAAATGGTAGGCGTCTCGACGCGTTTATAGACGACCTTACCTTTGAAGTAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATACAGCTCGGTCGCCCCCACAACCCAGTCACAGCTACGAGGACCATGGTGGACTGGAAGAAGCTGGGCAAATGCTTAGCCGATGCCGCTCCACCAATCCTCCCCTGCGGCCCGGATTCAACTCCCTCCCCCGAGGACACAGTCGAATCCATAAACATCATCACGGATCACATCTCTTCCGCGATCATAAGATCCTCAAAAGAAGTCGATGTGGAGGATAGCTTCCACCGCATCAGACTGTCCCCCGAACTTAGGAACCTCCTAAGAGTTAGAAACGCGGCAATCCGGGCCTACGATCAACTTCCCACGCACTCAAACCGGATTCGGATGCGTCGTCTACAGCGGGATGTAAAATCTCGCCTAAGCGACGCCCGAAATGAGAATTGGGATAGTTACTTAGAAGGACTCGCGCCCTCTCATCAAGCATACTGGCGACTAGCAAGGACTCTCAAGTCCGAAACTACCGCTACTATGCCTCCTCTCGTACGCCCTTCAGGCCAACCACCGGCTTTCGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAATACGCGGACCCCGAACACACCGAGGCAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCACCCTCGGACGCGTTACCCCCCATTACCTCTGACGAAGTTAGAGAAGTAATAGACAACCTTCAACCTAAGAAGGCACCCGGCTCCGACGGCATCCGAAACCGCGCGTTAAAACTCTTACCAGTCCAACTGATAACAATGTTGGCTACCATCTTAAATGCTGCTATGACGCACTGCATCTTTCCGGCGGTATGGAAAGAAGCAGACGTTATCGGTATACACAAGCCGGGCAAACCAAATAATGAAACCGCTAGTTACCGACCGATTAGTCTCCTCCCAGCGATAGGCAAAATTTACGAACGGCTCCTTCGGAAACGCCTCTGGGACTTCGTTACCGCGAATAAAATTCTAATAGACGAGCAGTTTGGATTCCGCGCCAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCTTAATAGGGCTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGATGTAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATCTTCAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCGTCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCATCTGACTGCCGGAGTCCCGCAAGGCTCCGCACTCTCCCCGTTACTATTTAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGTTGCTTCATCGGCGACTCCAGACCGCAGTAACCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATTAACCCCACGAAAAGCACAGCGGTGCTATTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCACCCCACTCCCCAGTAGGCGCGTAAACACCTCCGCCGTTAGCCCCATCACTCTCTTTGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCACGTAAAAACGGTACGCGATCGCGCCGCGTTTATACTAGGACGACTCTACCCAATGCTTTGTAGACGAAGCAAACTGTCCCTCCGTAACAAGGTAACCCTCTACAAAACTTGCATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCGGCCCGCACCAACTTGAAACCCCTTCAGGTAATACAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCAGAGGAACGTGGACCTCCACGATGACCTGGAGCTCGACCCCGTCAGTAAGTATCTACAGTCGGCATCGCTGCGCCACTTTGAGAAGGCGGCACGACATGAGAACCCTCTTGTCGTGGCCGCCGGAAACTACATACCCGATCCTGTAGACCGTTTGCATGATTCAAAACAAATTGTTGGCCGCTACCATCAATCAGTAAAGTCTAGTAAATCACAAACGTTCAACGAAGACAATTAG
Protein
MEEELLGFLGLLAEKYPVLSNLTAEFAAYRAARASPAPPASLAASFRAAQSCPAPKPNLSARTHVATHEAPSANEAPNAPATSFSPISSVASSVINNSGSDSDTGSEMDFESATSPQPGTSDGFQTVKRGKKRTRAVESRSSTTKQTKSATASRPQVVVTPESDSGRRATPPPRPKPASAQKTVAPPPLILQEKSAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGFHTYALQEDRELRVVIRGVPKELDIEYVREDLTAQSLPIVSVHRMHNGRDKKPYNMVLVALEPTPEAKKKIACLATVCGLSGVTIEAPHRRGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHATVDCSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRPTHPAPRTVGPKTSVPSAPKPAFVPAAVPTVSAWNKPLPYTRSGTQTAPQPPLATRPAPQPLLAPPPAPAYRPPQPSAVNDFTLVRDFVTAVNFDRLRSFADALRRAVNPEQRLAAAFDYMDVYESVAPFYNANGLARQRDQIYEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHSSNINGRRLDAFIDDLTFEVVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVIQLGRPHNPVTATRTMVDWKKLGKCLADAAPPILPCGPDSTPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPELRNLLRVRNAAIRAYDQLPTHSNRIRMRRLQRDVKSRLSDARNENWDSYLEGLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQYADPEHTEAVDREVERRASLPPSDALPPITSDEVREVIDNLQPKKAPGSDGIRNRALKLLPVQLITMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPNNETASYRPISLLPAIGKIYERLLRKRLWDFVTANKILIDEQFGFRAKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDVAKAFDKVWHNGLIFKLYNMGVPDRLVLVIRDFLSNRSFRYRVEGTRSRPRHLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQTAVTTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSTPLPSRRVNTSAVSPITLFDQPIPWAPKVKYLGVTLDRGMTFRPHVKTVRDRAAFILGRLYPMLCRRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFQRNVDLHDDLELDPVSKYLQSASLRHFEKAARHENPLVVAAGNYIPDPVDRLHDSKQIVGRYHQSVKSSKSQTFNEDN

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.0319013,     Score=93

Ontologies

GO

Topology

Length:
1462
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18028
Exp number, first 60 AAs:
0.0127
Total prob of N-in:
0.00058
outside
1  -  1462
 
 

Population Genetic Test Statistics

Pi
119.928818
Theta
113.932943
Tajima's D
0
CLR
0
CSRT
0.375781210939453
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号