SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01239
Annotation
reverse_transcriptase_[Papilio_xuthus]
Location in the cell
PlasmaMembrane   Reliability : 2.009
 

Sequence

CDS
ATGGCCATAAGGGCCCTGCGCGTGGCTATCGGGGAGGCGAAGGAGGCTGCTTGGAACGACCTACTAGCTTCGCTCGACTGTGATCCGTGGGGGCGGCCCTACAGGCTGGCGCGCAATGTGCTCCGCCCTTGGGCCCCCCCCGCAACCAGCACCCTGCCGCCGGAGACATTGCAGCGGGTAGTCGGGGGTCTGTTTCCGGATTTTACCGGGACGGCCTTCGTCCCCCCTGTGATGACGACGATGCGGGTTGCTGATGGCGGGGAGCCTGCGGACGTTTCGCAGGCGGAGTTTGAATCGGCTGTGCAGAGGATGCGGGCGAAGCGCACGGCTCCCGGTCCCGATGGGATCTCGTCCCGAGCGTGGGCGCTCGCCTTGACGGGCGATGGTTTGGGGCCTGCCCTCCGAAGGCTGTTCAGCCGGTGCCTCCGTGAGGGCAGGTTCCCAGAGCCATGGAGGACTGGTCGGCTCGTCCTTATTCCTAAGGAGGGTCGGCCACGTGACGAACCGAACGGGTACCGCCCAATCGTCGTGCTGGACGAGGCCGGTAAGCTCTTCGAGCGCGTCATCGCTAATCGCCTTGTCCAGCACCTGGAAAACGTTGGGCCTGATTTGGCTCCTAACCAATACGGTTTCCGGAGGGGTCGCTCGACCGTGGACGCGGTCTTGCGTGTCCGCCATCTCTCCGATTGTGCGTGCTCCGAGGGGGGCGTGTTGTTGGCTGTGTCGATTGACATCGCCAACGCCTTCAACACGATCCCCTGGAGCACGATCGTGGAATCACTTCGGTTTCACCGCATCCCCAATAGTCTCCGCACCCTGATAGAGGACTACCTCTCAGGGCGGAGCGTGATTTTCCCCGAGAGAAGAGGATGGGGACGAAAAACGGTGTCGTGCGGGGTACCACAGGGGTCGGTATTGGGACCACTCCTGTGGGACATCGGTTTCGACTGGGTCCTCCGCGGTGCTGGCCTGCGTGGCGTCGACGTGGTGTGCTATGCCGACGACACGTTGGTGACGGCTCGCGGAGCTGACTACAGGACCGCAGCGATCATTGCAACGGCGGCGGTCTCCACCGTCGTTAGCCGCATTCGGAGACTAGGTCTTGAGGTGGCCCTCCACAAGTCTGAGGCCGTATGCTTTCACCCGGTTCGGAGAGGACCCCCTCCGGGCGCGACGCTCATAGTCGGTGGAGTATCGATCGCTGTCCAGCCGAAGCTCAAATATTTGGGCATCGTGCTGGACAGTCGATGGCGCTTCGACCACCATTTTGGTGAGTTGATTCCGAGGCTACTGGGCATGGCAGGTGCGTTAGTCCGTCTTCTGCCCAACGTTGGTGGTTGCAGCGTCGGTGTCCGACGCCTGTACCTGGGGGTCGTGCGCAGTATGGCCTTGTATGGCGCTCCCGTGTGGTCGCCCACACTCTCCGCACGCAATGCGGCGCTGCTGCTCCGAGCTCAGCGAGCGCTCGCGGTGAGGGTCATCAGGGGGTACCGTACGATCTCCCGAGAGGTCGCCTGCGCCCTCGCTGGTTCCCTTCCTTGGGATCTCGAGGCCGAGGTATTGGCTACGGTATACCGGCGCAGGACACAGTCCCTGGGTCGGGGACGGACACCCGGCCTGTCGGCTGTCAGTCGGTGGAGGCGTGCTGCGCGTCATCTGGCGTACGCTAAATGGAGGGAGCGGTTGCTGGAGGAACTTCATCAAACCTCAGCCACCCGCCGGCGCACTCTCGAGGCCCTGGTGCCCGTGCTGGAGACATGGTCAGATCGGCGACACGGCGTGCTCTCCTTCCACCTTACGCAGGTCCTCTCGGGCATGGCTGCTTCGGGAGGTACCTGTGGAGGGTTTGCAGGAGAGAGCCACATCCGGGTTGTCACCAGTGCGGGCATCCGGATGATGACGCTCAGCACGCACTCGAAGCGTGCCCGCGTTGGGAGCACCCGCGGCGAGATCTCATCGCGGTGCTGGGGAGGGACCTCTCCTTGCGGGCTGTCATTGCCCGCATGCTAG
Protein
MAIRALRVAIGEAKEAAWNDLLASLDCDPWGRPYRLARNVLRPWAPPATSTLPPETLQRVVGGLFPDFTGTAFVPPVMTTMRVADGGEPADVSQAEFESAVQRMRAKRTAPGPDGISSRAWALALTGDGLGPALRRLFSRCLREGRFPEPWRTGRLVLIPKEGRPRDEPNGYRPIVVLDEAGKLFERVIANRLVQHLENVGPDLAPNQYGFRRGRSTVDAVLRVRHLSDCACSEGGVLLAVSIDIANAFNTIPWSTIVESLRFHRIPNSLRTLIEDYLSGRSVIFPERRGWGRKTVSCGVPQGSVLGPLLWDIGFDWVLRGAGLRGVDVVCYADDTLVTARGADYRTAAIIATAAVSTVVSRIRRLGLEVALHKSEAVCFHPVRRGPPPGATLIVGGVSIAVQPKLKYLGIVLDSRWRFDHHFGELIPRLLGMAGALVRLLPNVGGCSVGVRRLYLGVVRSMALYGAPVWSPTLSARNAALLLRAQRALAVRVIRGYRTISREVACALAGSLPWDLEAEVLATVYRRRTQSLGRGRTPGLSAVSRWRRAARHLAYAKWRERLLEELHQTSATRRRTLEALVPVLETWSDRRHGVLSFHLTQVLSGMAASGGTCGGFAGESHIRVVTSAGIRMMTLSTHSKRARVGSTRGEISSRCWGGTSPCGLSLPAC

Summary

Similarity
Belongs to the AB hydrolase superfamily. Lipase family.
EMBL
D85594    BAA19776.1    AB078931    BAC06456.1    AB078930    BAC06454.1    + More
AB078929    BAC06452.1    AB078935    BAC06462.1    AB090825    BAC57926.1    KZ149896    PZC78733.1    AB078936    BAC06464.1    LBMM01012027    KMQ86470.1    KQ460685    KPJ12887.1    LBMM01008448    KMQ88867.1    LBMM01002052    KMQ95336.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01015018    KMQ84954.1    LBMM01005948    KMQ91066.1    LBMM01006657    KMQ90417.1    LBMM01007425    KMQ89740.1    LBMM01015025    KMQ84953.1    LBMM01004634    KMQ92224.1    LBMM01015285    KMQ84870.1    LBMM01008422    KMQ88894.1    LBMM01003988    KMQ92922.1    LBMM01003575    KMQ93366.1    GAKP01002292    JAC56660.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GGMR01000779    MBY13398.1    LBMM01006063    KMQ90967.1    LBMM01014122    KMQ85315.1    ABLF02034925    LBMM01002480    KMQ94776.1    ABLF02011238    LBMM01005733    KMQ91252.1    LBMM01004505    KMQ92346.1    LBMM01004262    KMQ92649.1    LBMM01003245    KMQ93755.1    GGMR01015159    MBY27778.1    LBMM01004261    KMQ92650.1    LBMM01013668    KMQ85535.1    LBMM01005474    KMQ91485.1    GGMR01011682    MBY24301.1    ABLF02041557    GFXV01002090    MBW13895.1    GEHC01000964    JAV46681.1    LBMM01012412    KMQ86235.1    KU543683    AMS38371.1    GGMR01006838    MBY19457.1    GALA01001776    JAA93076.1    LBMM01008278    KMQ89009.1    LBMM01008445    KMQ88871.1    LBMM01009535    KMQ88053.1    ABLF02041886    AB593321    BAK38639.1    GALA01000302    JAA94550.1    GGFL01001583    MBW65761.1    KQ972691    KXZ75806.1    GALA01001777    JAA93075.1    LBMM01009610    KMQ87992.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GAPW01000192    JAC13406.1    QOIP01000014    RLU15074.1    GEHC01000915    JAV46730.1    LBMM01008682    KMQ88705.1    ABLF02010223    GAMC01020519    GAMC01020515    JAB86040.1    GFXV01003903    MBW15708.1    KXZ75807.1    AAZX01001144    GDAI01000741    JAI16862.1    KU543679    AMS38363.1    ABLF02013358    ABLF02013361    ABLF02054869    GAMC01020517    JAB86038.1    KQ972544    KXZ75869.1    GGFJ01001439    MBW50580.1    GGFJ01001727    MBW50868.1    GGFJ01001369    MBW50510.1    GGFK01005660    MBW38981.1    GGFL01001192    MBW65370.1    GGFJ01001370    MBW50511.1    KQ972226    KYB24577.1    ABLF02018808    GGFL01004044    MBW68222.1    ABLF02014650    ABLF02021100    LBMM01006977    KMQ90149.1    LBMM01005465    KMQ91492.1    GGMR01014195    MBY26814.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF01553   Acyltransferase
PF00098   zf-CCHC
PF00151   Lipase
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR029058   AB_hydrolase       
IPR013818   Lipase/vitellogenin       
IPR000734   TAG_lipase       
IPR000663   Natr_peptide       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53474   SSF53474       
Gene 3D
PDB
6AR3     E-value=2.21628e-05,     Score=117

Ontologies

Topology

Subcellular location
Secreted  
Length:
669
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.25986
Exp number, first 60 AAs:
0.00127
Total prob of N-in:
0.00390
outside
1  -  669
 
 

Population Genetic Test Statistics

Pi
0.012189
Theta
0.162652
Tajima's D
-1.467837
CLR
46.210669
CSRT
0.00104994750262487
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号