SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01238
Annotation
PREDICTED:_uncharacterized_protein_LOC106113369_[Papilio_xuthus]
Location in the cell
Mitochondrial   Reliability : 1.563 PlasmaMembrane   Reliability : 1.188
 

Sequence

CDS
ATGCGTTTCGCTTTGAAGGGTGGAGTAGCCGTTTATTGGTCGGTATTGGGACCACTCCTGTGGGACATCGGTTTCGACTGGGTCCTCCGCGGTGCTGGCCTGCGTGGCGTCGACGTGGTGTGCTATGCCGACGACACGTTGGTGACGGCTCGCGGAGCTGACTACAGGACCGCAGCGATCATTGCAACGGCGGCGGTCTCCACCGTCGTTAGCCGCATTCGGAGACTAGGTCTTGAGGTGGCCCTCCACAAGTCTGAGGCCGTATGCTTTCACCCGGTTCGGAGAGGACCCCCTCCGGGCGCGACGCTCATAGTCGGTGGAGTATCGATCGCTGTCCAGCCGAAGCTCAAATATTTGGGCATCGTGCTGGACAGTCGATGGCGCTTCGACCACCATTTTGGTGAGTTGATTCCGAGGCTACTGGGCATGGCAGGTGCGTTAGTCCGTCTTCTGCCCAACGTTGGTGGTTGCAGCGTCGGTGTCCGACGCCTGTACCTGGGGGTCGTGCGCAGTATGGCCTTGTATGGCGCTCCCGTGTGGTCGCCCACACTCTCCGCACGCAATGCGGCGCTGCTGCTCCGAGCTCAGCGAGCGCTCGCGGTGAGGGTCATCAGGGGGTACCGTACGATCTCCCGAGAGGTCGCCTGCGCCCTCGCTGGTTCCCTTCCTTGGGATCTCGAGGCCGAGGTATTGGCTACGGTATACCGGCGCAGGACACAGTCCCTGGGTCGGGGACGGACACCCGGCCTGTCGGCTGTCAGTCGGTGGAGGCGTGCTGCGCGTCATCTGGCGTACGCTAAATGGAGGGAGCGGTTGCTGGAGGAACTTCATCAAACCTCAGCCACCCGCCGGCGCACTCTCGAGGCCCTGGTGCCCGTGCTGGAGACATGGTCAGATCGGCGACACGGCGTGCTCTCCTTCCACCTTACGCAGGTCCTCTCGGGGCATGGCTGCTTCGGGAGGTACCTGTGGAGGGTTTGCAGGAGAGAGCCACATCCGGGTTGTCACCAGTGCGGGCATCCGGATGATGACGCTCAGCACGCACTCGAAGCGTGCCCGCGTTGGGAGCACCCGCGGCGAGATCTCATCGCGGTGCTGGGGAGGGACCTCTCCTTGCGGGCTGTCATTGCCCGCATGCTAGAGGACGAGAGTTCGTGGGAGGCCATGGCCAGATTTTGCGACCTGGTCATGGCGTCCCGCGAGGCTGAGGAGCGCGAAAGGGAGTGGAATCCCTCTTCGGCTCCTCAGCGAAGAAGGCGGGGTGGGCGACGCGGGCACGATGCTCCCGTTAATCTCCCGTAG
Protein
MRFALKGGVAVYWSVLGPLLWDIGFDWVLRGAGLRGVDVVCYADDTLVTARGADYRTAAIIATAAVSTVVSRIRRLGLEVALHKSEAVCFHPVRRGPPPGATLIVGGVSIAVQPKLKYLGIVLDSRWRFDHHFGELIPRLLGMAGALVRLLPNVGGCSVGVRRLYLGVVRSMALYGAPVWSPTLSARNAALLLRAQRALAVRVIRGYRTISREVACALAGSLPWDLEAEVLATVYRRRTQSLGRGRTPGLSAVSRWRRAARHLAYAKWRERLLEELHQTSATRRRTLEALVPVLETWSDRRHGVLSFHLTQVLSGHGCFGRYLWRVCRREPHPGCHQCGHPDDDAQHALEACPRWEHPRRDLIAVLGRDLSLRAVIARMLEDESSWEAMARFCDLVMASREAEEREREWNPSSAPQRRRRGGRRGHDAPVNLP

Summary

EMBL
D85594    BAA19776.1    KZ150386    PZC71062.1    AB078935    BAC06462.1    + More
AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    AB090825    BAC57926.1    LBMM01012027    KMQ86470.1    LBMM01008861    KMQ88580.1    KQ460685    KPJ12887.1    LBMM01006954    KMQ90166.1    LBMM01019839    KMQ83438.1    QOIP01000010    RLU18098.1    LBMM01019838    KMQ83439.1    LBMM01014132    KMQ85305.1    QOIP01000031    RLU14697.1    LBMM01006725    KMQ90373.1    LBMM01004505    KMQ92346.1    LBMM01015018    KMQ84954.1    LBMM01005733    KMQ91252.1    LBMM01003245    KMQ93755.1    LBMM01006671    KMQ90407.1    LBMM01004272    KMQ92618.1    LBMM01015025    KMQ84953.1    LBMM01007036    KMQ90099.1    LBMM01008682    KMQ88705.1    LBMM01006657    KMQ90417.1    LBMM01005216    KMQ91703.1    LBMM01002052    KMQ95336.1    LBMM01002480    KMQ94776.1    ABLF02014530    ABLF02018586    ABLF02058000    LBMM01014122    KMQ85315.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01004697    KMQ92167.1    LBMM01007425    KMQ89740.1    LBMM01004634    KMQ92224.1    LBMM01003988    KMQ92922.1    ABLF02011238    GDHF01014602    JAI37712.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GFXV01002242    MBW14047.1    LBMM01008422    KMQ88894.1    LBMM01006063    KMQ90967.1    LBMM01007659    KMQ89538.1    KU543679    AMS38363.1    GGMR01004600    MBY17219.1    LBMM01009738    KMQ87908.1    LBMM01006496    KMQ90570.1    LBMM01008448    KMQ88867.1    GAKP01002292    JAC56660.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    LBMM01008349    KMQ88951.1    LBMM01007638    KMQ89555.1    LBMM01014956    KMQ84982.1    GGMR01000779    MBY13398.1    LBMM01005465    KMQ91492.1    GGMR01006838    MBY19457.1    LBMM01005474    KMQ91485.1    ABLF02009991    ABLF02009992    ABLF02054952    GGMR01015159    MBY27778.1    GALX01004785    JAB63681.1    LBMM01012412    KMQ86235.1    GALA01001777    JAA93075.1    LBMM01021647    KMQ83033.1    KMQ94772.1    LBMM01008278    KMQ89009.1    GFXV01002090    MBW13895.1    GGMR01011682    MBY24301.1    GFXV01003903    MBW15708.1    GALA01001776    JAA93076.1    ABLF02041886    KQ972691    KXZ75805.1    AB593326    BAK38647.1    GBHO01002982    JAG40622.1    ABLF02034925    GGMR01012534    MBY25153.1    GECU01032129    JAS75577.1    AAZX01012143    AAZX01012194    ABLF02018942    ABLF02041885    GALA01000302    JAA94550.1    KU543683    AMS38371.1    ABLF02013358    ABLF02013361    ABLF02054869    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    GBXI01013438    JAD00854.1    GGMR01014918    MBY27537.1    GEHC01000964    JAV46681.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF01553   Acyltransferase
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
433
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
9.69166
Exp number, first 60 AAs:
9.27783
Total prob of N-in:
0.42996
outside
1  -  433
 
 

Population Genetic Test Statistics

Pi
14.367624
Theta
5.636928
Tajima's D
4.32352
CLR
0
CSRT
0.99990000499975
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号