SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01215
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.798 Nuclear   Reliability : 2.185
 

Sequence

CDS
ATGGTGGAGGCCCTTTCTAATTGGCCCCGCCACATGGCTGCCATTAGGGAGCGCCTAGGCCGCGCCCCCTCGGCGCGACCCTTCGGCACTGGTTTTAGGTTCCTGCCGTCGTCGGCTGAGGAATACAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGATAGTACCATTAAATGGTACTGCTATGCCCTGGCGGAGGAGATGCCCTCTAAGGTAGCTGTCCGGGGCCTCCCTGCCGACACCGACACGGCAGACGTTACCAACGCGTTGAAGGAGCTGGGGTTCCCGGCTCGATACGCTAGGTGCATTCGGTCCAAGAGAGGGCGACCGGGCAACGTGTTCCACGTTGCCCTGGATCACCTCTCAAAGGATGAACTCGCCCGCTTGTACTCAGTCAACGAACTGATGTACTTGCCGGGGGTGACGGTTGAGGGATGGCGACCAACCCGAGGGCCTGCGCAGTGTCACCGCTGCCAGGCCTACGGGCACGCCTCCCACAATTGTCACCGTGCGGTCCGCTGCGTGAGATGTGCTGCGGAGCACACTGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCATTCTCCTGCGCCAATTGCGGGAAGGACCACGCCGCCGTTGATAGGCGGTGCCCGGTCTACCGCAAGAAGGCCAGGATGATGGGAGTAACCGTCCCTCCTCCGGTACCACCGGTGCCACCGAGCAAAAGGAAATTGATGAAGAAAGCGCGAAGGGAGGCCTTAGAGAACGCTGCTCCCTCATCGGTTCCCGCAATACCTGCCATAGACATGGAGGTTGACATCAACCCCACTACCGACCACATAATCGATGATCAACAACCTGGAACATCTTCATTGCCCCAGGCACAACCGGCCACTTCAGGCATACAGCCCCCATTACCACCCCGCCCGCAGAGAGAGCGGCGCAGCGGCCGACAGGACACGCAGCCTGCCGGCTTCGCTGCCTGGCTCCTCTCCCTGTGGGAGAAACTGTCCGAGGAGCTGCGCATCATCTACTGGAACCCCGACGGGATAGGGTCCCGGAGGTCGGAGCTCATCCGACTCGCCCAGGAGTATGACCCGCAGGTTATCCTCCTGGGCGAGACCAAGCTCAAACCTCGACAAGATTTTAGGATGCCCAACTACTTCGTGTACCGACGGGACGAACTGACCTCCAACGGGCACCCGTTCAGGGGCACTGCGGCGCTCGTCAGGAGGGACGTGGTGCACGAGGAGCTTGAGCTACTGACCTTCGCCTCTACCAGAACGGTCGGGGTGAGGGTCCACGTACCGGGGGCCGAATTGCGGATTTATGCCGCGTATCGACCCCCGGGTCCTGATTTTGTCGAGGACGATATTAGACGGGCCTTGAACCATGATCGCCATCCGGCCTTGGTGGTCGGGGACCTCAATGCGAAACATGTCGCTTGGGGCTCCCGAATCATCACGCCGCCCGGAAGGCGATTGTACGAGGATGCCGAAAGGGGGGACTACTGCGTGGTCGGCCCCAACGAACCCACACACGTTCCAACGTTGGCCCGGTACCAACCGGACGTATTGGACGTGTGTGTTCACAAGGGGCTACAGTGCCCTCTAGCGATAGAGGCACTGTACGACCTGAGTACCCCTCACCTACCGATCTTGGTCACGGTGGGTTTGGGGCTCACTCGGGTCGCGACATCCCCTCTCAGGCCTAGGGTCGACTGGCAGTCCTTTACGGGACTGCTGGCCGACCAATCCTTGTTTCAAGACCCGTCTACCCCTGATGAGGTCGACACGGCGGCTTCCCGTCTCGTCGACACCATCAGGGGAGCCCTGGACCAAGTGACGACTCTGGTACCCAGCGGGGGGCCCAGAGCGGAACTCCCGGTGCACCTCAAGACGTTAATTCGTCGGAAGAGGGCACTGAGGAGGCTCTGGGCGACATCTAGGTGTCCCAGGATTAAGCGCGAGCTCAACCGACTTGAGGGGGAGCTGGCGACTAGGATGCGGACTTACCGGGGACGAGGGGGAAGACGGTGTTTTACACCGTTGGCTCGTGCCGAAGTCCTGGCCAACTCGCTGGAGCGGCAGTTCACTCCGAATGTCTCTGCACCCTCGATGGCTGCATTCCATCGCGAGGTGTCAGAGGGTGTAATCCAATTCCTCAAACCGGAATCGCCGGGAGTCGAGCTGGGAGATGACGACTTAGTCACTCCCAGCGAGGTGCGCCTCCTCATCAAGTTGATGAAGAGGCGCAAAGCCCCCGGCGAGGACGGTATTCCTCCCCTCGCCCTGCAAAACCTCCCTCCCTCAATCGTGTCAGCAATGACACGATTGTTTAATTCCATTCTCCGGGTAGGACACTTCCCTGGAACTTGGAAACTGGGCAAGATCATCGTCTTGCCCAAACCCGGCAAGGACAGGAGAAAGCCCTCCAGTTACCGACCGATTACCTTGCTCTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTCCTGAGGAGAATATCGCCGTATATTCTCCTCAGGCCGGAGCAATTCGGCTTTAGAAGCGGCCACTCGACGACTCTGCAACTGACCCGTGTCCTGCATCACTTGGCGGACCGGCGAAACTCGGGCCAATACACGGTCGCGGTCCTCCTCGATATCGAGAAGGCCTTCGACCGTGTGTGGCACGAGGGGCTGGTCCACAAGCTGCGGGACGCGGGCCTACCGCACGCTCACGTGCGACTGCTCGGGTCGTATCTGGAGGGCAGAACCTTCTTTGTCGCGGTCGAGGGCGCACGGTCTTCCGTGCGTCCCATTACGGCCGGGGTTCCCCAGGGTAGTGTCCTATCACCTATCCTATACGCCCTCTACACTAATGACATTCCCACCCTGGAGGGTCACCTTCGGGCGTGGGAGGAGGACGTGAAGTTGGCCTTGTTCGCTGACGACTCGGCCTACTTCTCGTCCTCCCCGTTCCCCTCTGCAGCCATCATGAGGATGCAGAGGCTTTTGGACATACTGCCCCAGTGGCTGGACCGTTGGAGAGTCGCGGTCAATGTGGGAAAGACCGCGGCCTTACTCTACGGTCCGGTCCGTATCAGAGTCGTCCCAAAGAAACTCAGCCTCCGAGGTGTGAATGTCGAGTTCAGGACCACGGTCCGGTATCTCGGATGCGACATCGACCGCTCTTTGAGCATGGTCGCGCACGTCAACCGAGTCATCGGTCAGGCTCGCGCGGCCATGTTCTTGTTGCGGCCGGTGTTTGCGTCCGGGCTTCCGACCAGGACCAAACTCGCCATTTACAAGACATACGTCCGTTCCCGCCTCACATACGCTGCTGTGGCCTGGTATCACCTGTTGTCGCCGTCCCAGCGATCTAGGTTGCAGGCCCAGCAGAGTCTTTCCCTCCGCATTATCGTCGGGGCCGGGCAGTACGTCAGAAATGACGTTATTGCCCGGGACCTAGGGGTGGAGTCGCTCGTGGAGTTTGTGACTAGGCTCGCCCGTAATATGTACGAGCGAGCCGAAAACGGGCCCCATGAGCATCTCCACAACATAGCCCCGCTGCACGCCAGACCACCGGATGGAGAGCAGCAGCCGCCCCCGGAAGAAGGGAAGAAAGAAGAAGAAGAAGGAAGAAAGAAGAGAAGAAGAGAAGAGTGA
Protein
MVEALSNWPRHMAAIRERLGRAPSARPFGTGFRFLPSSAEEYRAVQAYLSEASARDSTIKWYCYALAEEMPSKVAVRGLPADTDTADVTNALKELGFPARYARCIRSKRGRPGNVFHVALDHLSKDELARLYSVNELMYLPGVTVEGWRPTRGPAQCHRCQAYGHASHNCHRAVRCVRCAAEHTVADCPRPRDGPFSCANCGKDHAAVDRRCPVYRKKARMMGVTVPPPVPPVPPSKRKLMKKARREALENAAPSSVPAIPAIDMEVDINPTTDHIIDDQQPGTSSLPQAQPATSGIQPPLPPRPQRERRSGRQDTQPAGFAAWLLSLWEKLSEELRIIYWNPDGIGSRRSELIRLAQEYDPQVILLGETKLKPRQDFRMPNYFVYRRDELTSNGHPFRGTAALVRRDVVHEELELLTFASTRTVGVRVHVPGAELRIYAAYRPPGPDFVEDDIRRALNHDRHPALVVGDLNAKHVAWGSRIITPPGRRLYEDAERGDYCVVGPNEPTHVPTLARYQPDVLDVCVHKGLQCPLAIEALYDLSTPHLPILVTVGLGLTRVATSPLRPRVDWQSFTGLLADQSLFQDPSTPDEVDTAASRLVDTIRGALDQVTTLVPSGGPRAELPVHLKTLIRRKRALRRLWATSRCPRIKRELNRLEGELATRMRTYRGRGGRRCFTPLARAEVLANSLERQFTPNVSAPSMAAFHREVSEGVIQFLKPESPGVELGDDDLVTPSEVRLLIKLMKRRKAPGEDGIPPLALQNLPPSIVSAMTRLFNSILRVGHFPGTWKLGKIIVLPKPGKDRRKPSSYRPITLLSHVGKLFERLLLRRISPYILLRPEQFGFRSGHSTTLQLTRVLHHLADRRNSGQYTVAVLLDIEKAFDRVWHEGLVHKLRDAGLPHAHVRLLGSYLEGRTFFVAVEGARSSVRPITAGVPQGSVLSPILYALYTNDIPTLEGHLRAWEEDVKLALFADDSAYFSSSPFPSAAIMRMQRLLDILPQWLDRWRVAVNVGKTAALLYGPVRIRVVPKKLSLRGVNVEFRTTVRYLGCDIDRSLSMVAHVNRVIGQARAAMFLLRPVFASGLPTRTKLAIYKTYVRSRLTYAAVAWYHLLSPSQRSRLQAQQSLSLRIIVGAGQYVRNDVIARDLGVESLVEFVTRLARNMYERAENGPHEHLHNIAPLHARPPDGEQQPPPEEGKKEEEEGRKKRRREE

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
NWSH01000895    PCG73652.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02034467    + More
ABLF02023911    GEZM01008457    JAV94772.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01017470    PNF24199.1    NEVH01021205    PNF19912.1    GFTR01008279    JAW08147.1    GBBI01004395    JAC14317.1    GALX01005299    JAB63167.1    GFTR01008262    JAW08164.1    KQ973342    KXZ75569.1    AB055391    BAB21761.1    GGMS01002992    MBY72195.1    AB018558    BAA76304.1    NEVH01006736    PNF36716.1    GGMR01018716    MBY31335.1    NEVH01007402    PNF35856.1    NEVH01026154    PNF14491.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01019376    PNF22596.1    U07847    AAA17752.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01016302    PNF25823.1    NEVH01016340    PNF25410.1    NEVH01021925    PNF19341.1    NEVH01020940    PNF20481.1    GEZM01084969    JAV60363.1    KQ971729    KYB24751.1    GGMR01003407    MBY16026.1    NEVH01026386    PNF14434.1    GFTR01008246    JAW08180.1    GFXV01000908    MBW12713.1    GGMR01016296    MBY28915.1    NWSH01000032    PCG80496.1    GGMR01000226    MBY12845.1    KQ459265    KPJ02064.1    KU543673    AMS38352.1    GGMR01000676    MBY13295.1    GGFJ01001822    MBW50963.1    GGMS01006359    MBY75562.1    AF081103    AAC72921.1    GBBI01003810    JAC14902.1    GGMS01017365    MBY86568.1    GFXV01002840    MBW14645.1    M22874    M38643    RPOV01000134    RPJ78669.1    KK119692    KFM76444.1    GGMR01012283    MBY24902.1    GGMR01012676    MBY25295.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=5.86397e-06,     Score=124

Ontologies

Topology

Length:
1210
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0603500000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1210
 
 

Population Genetic Test Statistics

Pi
389.853
Theta
180.169236
Tajima's D
3.652454
CLR
20.439018
CSRT
0.995900204989751
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号