SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01198
Annotation
PREDICTED:_neurofilament_medium_polypeptide-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.203
 

Sequence

CDS
ATGGCCACAACAATAAAGGAGGCCACGGAAGATCTAGCTTCCAGATCGGCCAACGAGGAAACCCTGAGGCTGCAGGCACTCAGCGAGAGACAGGAGGCGGAGATCCTGCAGCTCAGGAAGGAAGTAGAGGACGTAAGAGCGGAAATGGTGCGCCTCGCTCAGACGACAGCGCAGCCCACTCCCGCCCCAACACTGCCAAACGAAGAGGACGAGCGACGCCTGCAGATAATCATGCGAGCAGTCGGGTCCATGCTGGACGCCCGACTCGCGGGTCTGGAGGCCCGTCTACTCCCAGAGCCTCGCTTGCGACCACCTTTGGCCGCTGACGCAAGAAGGAGGAGCAGAGAGAGCGAAATCGATCCAGACACTGTAGGTCTTGTGTCGGAGGCAACGCCGCCTTATGCGGCTCTGCCCCAGCTTGAGACCAACAAGAAAGTGAAGCCCAAGAAACAGAAGGGCAATAACAAGAAGACGACGCCGTCAGCTCCACCCGAGCCGCCAGCTCCACCCGAGCCGCGCGCATTCCCTCCGGCCCCCGCTGCCCTTACGGTCAGTTGGGCGACCGTTGCGCGTAGAGGAGCACGGCCGAGAAGGGAAAAGGAGCCAGCACCGACGACCAACGCGGAAGGCCAACGAGACAGAAACCCTGCCCCGCTCAAGCCTAAGAAGAAAGGTAGAAAGAAGAGACTTCGAGCTCCGCGCTCGCAGGCCGTTATTCTGAGGCTGCACCCGGAGGCCATCGAAAAGGGGCTCTCCTACCGGGAGGTACTCGCCGAGGCGAGGGCCAGCATCGACGCCGGAGCCTTAGGGATCCCCATCGAGAAGGTCCGGTCAGCAATAACCGGAGCCAAAATACTCATAGTGAGCGGCGAGGACCAGATCGCGAAGGCCGACTTGCTGGCCGAGAAGCTCAAGGAGGTTCTCTCTTCCAAGAGAGTAACGGTGACAAGACCGATAGTGACCGCTGCAATCCGCATAAGCGGACTTGACGATTCGCTGACGGAGGAGGAGATATGCACCGAGCTTGCGCGCATCGGCGAATGCTCCGTCGATGCAGTCAAGGCTGGCTCTATCAAGCCCGGATCCGGAGGAATGGGCCAGGTTCTCGTTCGTTGCCCGATAGCAGCGGCGAAGAAAATTGTTACAGTGACGAAGCTGCGCATCGGGTGGAGCGTTGTTCGCGTCCACCTGCTGGAGGCCCGGAGGCTACAATGCTTCCGCTGCCACGCGTTGGGCCATGTGGGTGCGCGGTGCCCGTCGTCGGTCGACCGCAGCCACGACTGCTACCGGTGCGGACAGACCGGCCACGTGGCATCCGGATGCACACTGGCACCGCGATGCGCCGTCTGCGCCTCCGCCGGGAAACCAGCGGACCACACTTCGGGGGGCAAGGCCTGTGCAAGGCCCCCGAGAAAACCGAGGAGAGAGGACGTCGCTGCACCCGCGGCCGCACCCGTTGCTGCAGACCGAAGTCAACTCGGCGAGACGACGACTCCGATGGACGTCCAGCCTCCGTCGGGCACAAGGAAGACCGGGGCTTTATGA
Protein
MATTIKEATEDLASRSANEETLRLQALSERQEAEILQLRKEVEDVRAEMVRLAQTTAQPTPAPTLPNEEDERRLQIIMRAVGSMLDARLAGLEARLLPEPRLRPPLAADARRRSRESEIDPDTVGLVSEATPPYAALPQLETNKKVKPKKQKGNNKKTTPSAPPEPPAPPEPRAFPPAPAALTVSWATVARRGARPRREKEPAPTTNAEGQRDRNPAPLKPKKKGRKKRLRAPRSQAVILRLHPEAIEKGLSYREVLAEARASIDAGALGIPIEKVRSAITGAKILIVSGEDQIAKADLLAEKLKEVLSSKRVTVTRPIVTAAIRISGLDDSLTEEEICTELARIGECSVDAVKAGSIKPGSGGMGQVLVRCPIAAAKKIVTVTKLRIGWSVVRVHLLEARRLQCFRCHALGHVGARCPSSVDRSHDCYRCGQTGHVASGCTLAPRCAVCASAGKPADHTSGGKACARPPRKPRREDVAAPAAAPVAADRSQLGETTTPMDVQPPSGTRKTGAL

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
514
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00176
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00654
outside
1  -  514
 
 

Population Genetic Test Statistics

Pi
112.725296
Theta
39.152003
Tajima's D
2.167138
CLR
0.384279
CSRT
0.907154642267887
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号