SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01197
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.058 PlasmaMembrane   Reliability : 1.445
 

Sequence

CDS
ATGATATTTCGAGATTGGGGCTTTGGGGACGGGGAGGCCGTCTGTGGGGGTGGGGTGGCCTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAAAGACATGGAGTGCCCCTCTACCTTCGCCGGCTGGTCGGCTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGGTCGTACATCGGTTTCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTACTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATATGTTACGCAGACGACACGCTGGTCGTGGCCCGGGGAGGGAGCTTTGCTGAGTCTGCTCGTCTTGCCACCGCTGGGGTAGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCATAGGCCTCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATCGGGGTCGGGGTGCAGTTAAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGCACCTGGTCCCTGGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTTCCCAACATCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGGGGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTAACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGTGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGATTCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCTACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTTGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCAACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCTAGCCCTGGCCCTCTAA
Protein
MIFRDWGFGDGEAVCGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPLYLRRLVGSYLEDRSVTCTGHGGVVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPGLLGVAGALSRLLPNIGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLGAEALAADYQWRANLRARGVARPSPSVVRVRRAQSRRSVLESWSRRLADPSAGRRTVEAIRPILVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECYHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGNDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLALALAL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    KZ150386    PZC71062.1    D85594    BAA19776.1    LBMM01005707    KMQ91279.1    LBMM01024063    KMQ82623.1    LBMM01006954    KMQ90166.1    LBMM01019839    KMQ83438.1    LBMM01006657    KMQ90417.1    LBMM01005733    KMQ91252.1    LBMM01019838    KMQ83439.1    LBMM01006671    KMQ90407.1    LBMM01008682    KMQ88705.1    LBMM01004272    KMQ92618.1    LBMM01002052    KMQ95336.1    LBMM01006063    KMQ90967.1    LBMM01003245    KMQ93755.1    LBMM01006725    KMQ90373.1    LBMM01007036    KMQ90099.1    LBMM01015018    KMQ84954.1    LBMM01004634    KMQ92224.1    LBMM01005948    KMQ91066.1    LBMM01004505    KMQ92346.1    LBMM01003988    KMQ92922.1    LBMM01015025    KMQ84953.1    LBMM01002480    KMQ94776.1    LBMM01014956    KMQ84982.1    LBMM01008422    KMQ88894.1    LBMM01008448    KMQ88867.1    LBMM01007425    KMQ89740.1    LBMM01005216    KMQ91703.1    KMQ94772.1    LBMM01021647    KMQ83033.1    LBMM01012412    KMQ86235.1    LBMM01014122    KMQ85315.1    LBMM01005465    KMQ91492.1    LBMM01008278    KMQ89009.1    GGMR01000779    MBY13398.1    LBMM01005474    KMQ91485.1    GGMR01014195    MBY26814.1    LBMM01006496    KMQ90570.1    LBMM01009527    LBMM01009515    KMQ88059.1    KMQ88067.1    ABLF02011238    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01004262    KMQ92649.1    LBMM01004261    KMQ92650.1    GFXV01002090    MBW13895.1    ABLF02013358    ABLF02013361    ABLF02054869    GGMR01015159    MBY27778.1    GFXV01001748    MBW13553.1    GGMR01015354    MBY27973.1    ABLF02034925    QOIP01000031    RLU14697.1    ABLF02005203    ABLF02041316    QOIP01000010    RLU18098.1    LBMM01007659    KMQ89538.1    ABLF02041886    GALX01004785    JAB63681.1    LBMM01015285    KMQ84870.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GGFJ01001369    MBW50510.1    LBMM01013668    KMQ85535.1    GGFJ01001727    MBW50868.1    GGMR01004600    MBY17219.1    GGFJ01001439    MBW50580.1    LBMM01005845    KMQ91162.1    GFXV01002242    MBW14047.1    ABLF02004597    ABLF02041324    ABLF02041323    ABLF02041325    ABLF02004854    ABLF02041317    GGMR01012748    MBY25367.1    GGFJ01001370    MBW50511.1    GFXV01003903    MBW15708.1    GGMR01006838    MBY19457.1    LBMM01004697    KMQ92167.1    GBXI01013438    JAD00854.1    LBMM01003575    KMQ93366.1    AB593321    BAK38639.1    KQ972691    KXZ75807.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
497
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.01777
Exp number, first 60 AAs:
0.27723
Total prob of N-in:
0.01795
outside
1  -  497
 
 

Population Genetic Test Statistics

Pi
46.568084
Theta
41.218659
Tajima's D
0.639966
CLR
0.231873
CSRT
0.570071496425179
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号