SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01160
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Amyelois_transitella]
Location in the cell
PlasmaMembrane   Reliability : 2.638
 

Sequence

CDS
ATGATCCTCCTGCTTGTGGATGAGCTTATCCCTATCATTACATATATTCTTAACTTCTCTCTCCTAAAAGGCTCATTCCCAAGTAGCTGGAGAAAGGCTCATGTTCTCCCACTTCCTAAGGTCCCTAATCCTTCCTCTTTTTCTCAGTTTCGTCCAATCTCAATACTTCCCATTCTCTCTAAAGTCTTGGAGGGTTTAGTCCAAAGACAGCTCACTGTCTTTCTTAATAAAAACAATCTCCTCAACTCTTTTCAGTCTGGTTTCCGCCAAGGCCACAGCACGGTCACTGCATTGCTCAAGGTCACCGACGACATTCGCCACGCGATTGATGTGGGGCAGCTAACCGTGTTGACCTTATTGGACTTCAGCAGTGCATTTAACTCAGTAGACTTTGACATCCTTCTAAGTATCCTTGGATCTCTTAATGTATCTCCACTTGCTCTAACCTGGTTTGAATCTTATCTTCGGGGACGCTCGCAATGTGTCCGCTCTGATGATGCTACATCGAAATGGTGTGATTTAACTGTGGGTGTACCTCAAGGTGGCGTACTATCTCCTCTGCTTTTCTCTATTTTTATTAACGAAATCACCCAGGTGCTGACTTCTCACTACCATCTCTACGCTGACGATTTGCAGATTTATAGACATTTTAAAGCTGATGATGTTGCTCTAGCTATTGCTGAAATCAATGGAGATCTTGATAGAATTAGTGCTTGGGCTAAATCTTTTGGACTTCTTGTGAATCCATCAAAATCACAGGTCATAGTAATTGGTAGTTCCTATAGGTACAACACGATTGACCACATTAATTTGCCCCCTGTGACGCTAGATGGAATTCCAATCGCTTATTCTAAAACAGCAAAAAACCTAGGTATCGTTCTTGATTGTCATCTCTCTTGGTCCAGTCAGATAAATTTAGTTAGCAGGAAAGTGCATTGCACGTTTCAGTCTCTCAAGCGTCTTCAGCGTTTCTTGCCCTTTGAAGCTAAAGTCACCCTGGCCCAATCCCTTATGCTTCCTCTCCTTGACTATGCGGATGTCTGTTTCCTCGACGCCGCGGAGGGGCTATGGAACAAACTGGAAAGGTTACAAAATTTATGCATACGCTTTATTTTTGGTTTACGCAAGTATGATCATGTCTCGCAGTACAGATCACAACTTAATTGGTTGCCTATCCGACTTCGCCGTGATGCACATGTTTTATGTATGCTGTTCAACATCCTCAATAACCCAGCTGTTCCCCAGTACCTCCGTGAGCGCTTCGAGTACCAGATGCCCCGTGGTGTACCCTGTCGTACAAGTAGATCCCTTCTCCTTAATTTTCCCCCTCACTCCTCCAGCCGCTACGGTGGTTCGTTCACTGTGCACTCTGTGCGTCTGTGGAACTCAGTTCCACACTCAATCCGTGCAAGTCCCTCACTTGAAGTTTTCAGGAAGGCATTAAAGGAGCACTATCTATCAATTTAG
Protein
MILLLVDELIPIITYILNFSLLKGSFPSSWRKAHVLPLPKVPNPSSFSQFRPISILPILSKVLEGLVQRQLTVFLNKNNLLNSFQSGFRQGHSTVTALLKVTDDIRHAIDVGQLTVLTLLDFSSAFNSVDFDILLSILGSLNVSPLALTWFESYLRGRSQCVRSDDATSKWCDLTVGVPQGGVLSPLLFSIFINEITQVLTSHYHLYADDLQIYRHFKADDVALAIAEINGDLDRISAWAKSFGLLVNPSKSQVIVIGSSYRYNTIDHINLPPVTLDGIPIAYSKTAKNLGIVLDCHLSWSSQINLVSRKVHCTFQSLKRLQRFLPFEAKVTLAQSLMLPLLDYADVCFLDAAEGLWNKLERLQNLCIRFIFGLRKYDHVSQYRSQLNWLPIRLRRDAHVLCMLFNILNNPAVPQYLRERFEYQMPRGVPCRTSRSLLLNFPPHSSSRYGGSFTVHSVRLWNSVPHSIRASPSLEVFRKALKEHYLSI

Summary

EMBL
NWSH01000817    PCG74070.1    NWSH01000468    PCG76206.1    GEBQ01022205    JAT17772.1    + More
GEBQ01020572    JAT19405.1    GEBQ01027915    JAT12062.1    GEBQ01013060    GEBQ01010336    JAT26917.1    JAT29641.1    GEBQ01031972    JAT08005.1    ODYU01007705    SOQ50729.1    GECU01032510    JAS75196.1    GANO01004126    JAB55745.1    GBBI01004799    JAC13913.1    GANO01003893    JAB55978.1    GANO01004338    JAB55533.1    KQ461198    KPJ06072.1    LBMM01010997    KMQ87090.1    GBHO01045128    JAF98475.1    DNUT01000248    HBI40237.1    GECU01000221    JAT07486.1    DNUT01000258    HBI40281.1    AAZX01023386    LBMM01014048    KMQ85356.1    LBMM01004152    KMQ92759.1    LBMM01003452    KMQ93522.1    DNUT01000451    HBI40968.1    QOIP01000006    RLU21552.1    DMQF01000113    HAO14334.1    DNUT01000056    HBI39512.1    DMQF01000003    HAO13943.1    DMQF01000352    HAO15199.1    DMQF01000396    HAO15350.1    GDHC01000945    JAQ17684.1    GBHO01031326    GBHO01031325    JAG12278.1    JAG12279.1    GBHO01007781    JAG35823.1    DNUT01000170    HBI39961.1    DMQF01000436    HAO15547.1    DMQF01000157    HAO14486.1    GEZM01034710    JAV83652.1    GBHO01012041    GBHO01012038    JAG31563.1    JAG31566.1    DNUT01000374    HBI40695.1    GANO01004166    JAB55705.1    DNUT01000297    HBI40414.1    GEZM01027174    GEZM01027173    JAV86813.1    DMQF01000361    HAO15230.1    NWSH01006271    PCG63543.1    NWSH01000010    PCG80923.1    GANO01004070    JAB55801.1    GEZM01039829    JAV81150.1    GEZM01007604    JAV95063.1    KZ150070    PZC74075.1    GANO01004066    JAB55805.1    GBHO01034750    JAG08854.1    GANO01004238    JAB55633.1    KQ458880    KPJ04628.1    GANO01004258    JAB55613.1    AFYH01007667    GFDF01007660    JAV06424.1    LBMM01008498    KMQ88826.1    GANO01004325    JAB55546.1    GANO01004094    JAB55777.1    AAZX01002422    AAZX01014809    GEZM01041318    GEZM01041317    JAV80524.1    GBHO01019121    JAG24483.1    GEBQ01026990    JAT12987.1    LSMT01000554    PFX16333.1    MRZV01000114    PIK58376.1    GEZM01037808    JAV81920.1    GANO01004362    JAB55509.1    GAMC01021038    GAMC01021033    GAMC01021031    JAB85522.1    GAMC01021037    GAMC01021036    JAB85519.1    GEZM01045590    GEZM01045589    JAV77734.1    GANO01003995    JAB55876.1    HAEI01003198    SBR83602.1    GANO01004361    JAB55510.1    HAEG01016041    SBS01700.1    GANO01004198    JAB55673.1    AAZX01023421    AAZX01025062    AAWZ02022173   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR000477   RT_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR011011   Znf_FYVE_PHD       
SUPFAM
SSF56219   SSF56219        + More
SSF57903   SSF57903       
Gene 3D
PDB
6AR3     E-value=1.02142e-05,     Score=118

Ontologies

Topology

Length:
488
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.648799999999999
Exp number, first 60 AAs:
0.42179
Total prob of N-in:
0.01929
outside
1  -  488
 
 

Population Genetic Test Statistics

Pi
205.346523
Theta
129.597137
Tajima's D
3.084825
CLR
0
CSRT
0.980850957452127
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号