SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01146
Pre Gene Modal
BGIBMGA007461
Annotation
PREDICTED:_glucose_transporter_type_1_[Bombyx_mori]
Full name
Glucose transporter type 1      
Location in the cell
PlasmaMembrane   Reliability : 4.952
 

Sequence

CDS
ATGAATCTGTCGGCCAAACTTGAGGAGCTCCAGGGAGGCGACCGACAGCTGGAAACTACGGCCGCACTCTGCGAGATCAGAACGCAGCTGCAAGAGTTTACCAAGAGCGTGGAGTCATGCCAGAGTGAAGTTTCAGAGGTAAAACGGGATATGGTAGCCATCAAGCAAGAACTGGAGACTGTACAACTGGTGAAGGAAGAAATAGAAGAACTCCGCGAATATGTTGATAGGCTCGAGGAACACACCCAACAGAGGAAACTCAGGCTGCTCGAACAAGGCCTCACATTCTTCCTGTCGTACGCTATTTTTACGGCGGTGTTGGGAATGTTACAATTCGGATACAACACCGGAGTCATCAATGCTCCTGGGAAAAACATCGCAAACTTCATAAAGGATGTATATAAGAGTCGATACGGGATGGATCTGCACGATGACACGGTCAACAGGCTGTACTCAGTAGCGGTCAGCATCTTCGCCATCGGGGGCATGGTGGGGGGCTTCTCGGGCGGAATGATTGCCAACCGGTTCGGAAGGAAAGGAGGGTTATTGCTCAACAACGTACTCGGCATCGGCGGCGCGAGCCTCATGGGCTTTACCAGGATCTCGCATTGCTACGAATTCCTCATCTTTGGCAGATTTATTATAGGCGTCAACTGCGGTCTGAACACGTCCTTAGTGCCAATGTACATATCGGAGATAGCTCCCCTGAACCTGAGGGGCGGATTGGGCACCGTCAACCAGCTTGCCGTCACAGTCGGCTTGCTGATCTCCCAGGTTCTGGGCATCGAACAGATTCTTGGAACGGACGAAGGATGGCCAATATTGTTAGGTCTCGCCATCTGTCCAGCGGTTCTACAGTTGGTCCTGCTCCCGGCCTGTCCCGAATCTCCTAGATATTTACTCATCACTCGTCAATGGGAAGAAGAAGCGAGGCGAGCTCTGAGGAGACTGCGAGCTAGTAATCAAGTCGAAGAGGATATTGAAGAGATGAGAGCGGAAGAGCGAGCCCAGCAATCGGAGGCTTCTATTTCGATGCGAGAGTTGCTCTGCTCGCCGACGCTGCGGGCGCCGCTCCTCATCGGAGTCGTGATGCAGCTCTCTCAGCAGCTTAGCGGAATCAATGCGGTGATAAACTACTCCACGTTTCTCTTCACTTCTTCGGGCCTGACGGAGGAGTCGGCGAAGTTTGCAACAATGGGCATCGGGGCCATCATGGTCGGGATGACGTTGGTGTCTTTGCCGCTGATGGACAGAACTGGACGACGCACCCTTCATCTGTACGGTCTCGGAGGAATGTTCATCTTCTCCATCTTCATCACGATCTCCTTCCTAATAAAGGAGTTCTTCGGTTATGTGCAGGAAATGATCGACTGGATGAGCTACCTGTCGGTGGTGTCGACGCTCAGCTTCGTGGTGTTCTTCGCCGTGGGCCCCGGCTCCATACCCTGGCTGATCACGGCGGAGCTCTTCTCCCAGGGTCCGCGGCCGAGCGCCATGGCGATTGCCGTCTTAGTTAACTGGATGGCGAATTTCGTTGTCGGAATCGGTTTCCCGAGCATGAAGGCGGTGCTGGACAACTACACGTTCCTCCCGTTCAGTGTCTTCCTGGCGATCTTCTGGATATTCACATACAAAAAGGTTCCCGAGACGAAAAATAAGACCTTCGAAGAGATATTAGCGCTGTTCCGGAATTCGAACGGCAGGGACAGCTTCCGCGACGACCACATCTACGGCAGCGCGTTGAACTGCGTCAACGGTCTGGAGCAGCAGCTGCTCCCCCCGCCGCCGCCGCCCCTCCCCGCGCCCCTCGACGTCAAACGCGACTCAGGCAAGTCGAACTCTACGCTTTAA
Protein
MNLSAKLEELQGGDRQLETTAALCEIRTQLQEFTKSVESCQSEVSEVKRDMVAIKQELETVQLVKEEIEELREYVDRLEEHTQQRKLRLLEQGLTFFLSYAIFTAVLGMLQFGYNTGVINAPGKNIANFIKDVYKSRYGMDLHDDTVNRLYSVAVSIFAIGGMVGGFSGGMIANRFGRKGGLLLNNVLGIGGASLMGFTRISHCYEFLIFGRFIIGVNCGLNTSLVPMYISEIAPLNLRGGLGTVNQLAVTVGLLISQVLGIEQILGTDEGWPILLGLAICPAVLQLVLLPACPESPRYLLITRQWEEEARRALRRLRASNQVEEDIEEMRAEERAQQSEASISMRELLCSPTLRAPLLIGVVMQLSQQLSGINAVINYSTFLFTSSGLTEESAKFATMGIGAIMVGMTLVSLPLMDRTGRRTLHLYGLGGMFIFSIFITISFLIKEFFGYVQEMIDWMSYLSVVSTLSFVVFFAVGPGSIPWLITAELFSQGPRPSAMAIAVLVNWMANFVVGIGFPSMKAVLDNYTFLPFSVFLAIFWIFTYKKVPETKNKTFEEILALFRNSNGRDSFRDDHIYGSALNCVNGLEQQLLPPPPPPLPAPLDVKRDSGKSNSTL

Summary

Description
Facilitative glucose transporter.
Similarity
Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family.
Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family. Glucose transporter subfamily.
Keywords
Alternative splicing   Complete proteome   Glycoprotein   Membrane   Reference proteome   Signal   Sugar transport   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Glucose transporter type 1
splice variant  In isoform T.
EMBL
BABH01036247    KQ459593    KPI96736.1    NWSH01001179    PCG72228.1    AGBW02009564    + More
OWR50443.1    JTDY01001975    KOB72419.1    ODYU01003758    SOQ42927.1    ADTU01021729    ADTU01021730    ADTU01021731    ADTU01021732    KQ978169    KYM96596.1    KQ461108    KPJ09063.1    KQ414627    KOC67429.1    NEVH01006723    PNF37037.1    KQ434938    KZC12054.1    GL888384    EGI61918.1    CH940647    KRF84716.1    AF064703    AE014296    AY059441    BT011383    AAC36683.2    AAL13347.1    CM000363    EDX08746.1    JRES01000997    KNC26281.1    CH480817    EDW49982.1    PNF37040.1    CH933809    EDW19603.2    GL452187    EFN77800.1    CM000159    KRK00711.1    CH954178    KQS43044.1    CM002912    KMY96742.1    JR035629    JR035630    AEY56555.1    AEY56556.1    CH902618    EDV39546.2    OUUW01000009    SPP84932.1    ADMH02001654    ETN61547.1    AAAB01008807    EAA04274.4    EAA45418.4    GL769399    EFZ10419.1    KQ982766    KYQ50974.1    KQ976417    KYM89830.1    KK853156    KDR10507.1    KZ288223    PBC32012.1    PNF37047.1    CH477280    EAT44948.1    CH916366    EDV97447.1    GGFL01004974    MBW69152.1    KQ981953    KYN32497.1    BABH01015756    KK107485    EZA50096.1    QOIP01000006    RLU21458.1    GEDC01012296    JAS25002.1    GEDC01029784    JAS07514.1    GL436428    EFN72020.1    AJWK01006616    GEDC01021510    JAS15788.1    GEDC01014486    JAS22812.1    NNAY01002971    OXU20201.1    DS235862    EEB19241.1    ACPB03000235    KZ150024    PZC74841.1    GDHC01007983    JAQ10646.1    UFQT01000606    SSX25662.1    SSX25663.1    SSX25660.1    SSX25659.1    KQ435867    KOX70255.1    CCAG010010357    CCAG010010358    CCAG010010359    CVRI01000035    CRK92725.1    GGMS01010501    MBY79704.1    LBMM01005725    KMQ91266.1    GGMR01019187    MBY31806.1    KB630363    KB631141    KB631630    ERL83558.1    ERL84132.1    ERL84865.1    JXJN01006710    JXJN01006711    JXJN01006712    JXJN01006713    PNF37041.1    CP012525    ALC43499.1    PNF37052.1    KQ971321    KYB28667.1    PNF37053.1    GEZM01088895    JAV57840.1    GFDL01003013    JAV32032.1    GFDF01007799    JAV06285.1    ABLF02029341    ABLF02029346    PNF37042.1    PNF37044.1   
Pfam
PF00083   Sugar_tr        + More
PF00450   Peptidase_S10
Interpro
IPR036259   MFS_trans_sf        + More
IPR005829   Sugar_transporter_CS       
IPR020846   MFS_dom       
IPR003663   Sugar/inositol_transpt       
IPR005828   MFS_sugar_transport-like       
IPR001563   Peptidase_S10       
IPR018202   Ser_caboxypep_ser_AS       
IPR033124   Ser_caboxypep_his_AS       
IPR029058   AB_hydrolase       
SUPFAM
SSF103473   SSF103473        + More
SSF53474   SSF53474       
Gene 3D
PDB
5EQI     E-value=3.55579e-103,     Score=960

Ontologies

Topology

Subcellular location
Membrane  
Length:
616
Number of predicted TMHs:
11
Exp number of AAs in TMHs:
241.94552
Exp number, first 60 AAs:
0
Total prob of N-in:
0.84821
outside
1  -  95
TMhelix
96  -  118
inside
119  -  149
TMhelix
150  -  172
outside
173  -  181
TMhelix
182  -  201
inside
202  -  207
TMhelix
208  -  230
outside
231  -  239
TMhelix
240  -  262
inside
263  -  270
TMhelix
271  -  290
outside
291  -  393
TMhelix
394  -  416
inside
417  -  422
TMhelix
423  -  445
outside
446  -  464
TMhelix
465  -  487
inside
488  -  499
TMhelix
500  -  517
outside
518  -  526
TMhelix
527  -  544
inside
545  -  616
 
 

Population Genetic Test Statistics

Pi
150.823485
Theta
150.99897
Tajima's D
-0.451747
CLR
0.275361
CSRT
0.253737313134343
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号