Gene

KWMTBOMO01139  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA007473

Annotation

PREDICTED:_tudor_and_KH_domain-containing_protein_[Bombyx_mori]

Location

Bomo_Chr3(+):3188782-3205336      View in EpiBrowser

Full name

Tudor and KH domain-containing protein homolog       + More
Katanin p80 WD40 repeat-containing subunit B1      

Alternative Name

Partner of PIWIs protein
p80 katanin

Location in the cell

Nuclear   Reliability : 2.511

CDS

ATGTCATTGAACACAAAATTAGCTTTGCCCATTGCTTTGGGCTTGTCCCTCGTGACTGTAACAGCATTTGTGGCCTACTATGTCCTCAAGAGAGATGAAGAAGAAAACGATAACAAGACAGTCAAGATTACTAAAATAAATACAATTGAAATTCATGTTCCTAAAAGCATTGTTCCAGCTCTGATTGGTCGCAATGGCTCCAACATTAAGGACCTTCAGAAGAAATCTGGTGCACAGATCCATTTCAAAAAGTTCACCGACCAGGACTATGATGTGTGTGTAGTCAGAGGACGAGCTGACACTACTCAGCTGGCTGAAACTTTAATACATGACTTTATCAAGCAACAGCCAACAATTATGTCAGAAAGTATTACTGTGCCAAGCTGGTCTTGTGGGAGAATAATTGGATCTGGAGGTGAGAACGTCAATGATATTAGCCATCGCAGTGGCGCTCGCGTCAAGGTCGAAAGTCCTAAAAGTACAGATAAAGTTGCTGAGCATCTAGTGACATTCCGTGGTACCAAGGAACAGATTGAAGTCGCCAAGAAACTTGTTGAGAACTGCATATCTTTAGAGCGGTGTAGACGGGAGATAGAGCAGTCGAAGCGTCCGCCCCGGCACAGCTCGTCGCCCCCCTCCCCCTGCCCCTCGCCCGGCGACCGCGACGCGGACGCGGACGCACAAGAGACAACGGGACCCAGTATCGAAGTGTACGTGTCGGCGGTTTCATCTCCTTCCCGTTTCTGGGTGCAGTTCGTAGGGCCCCAGGTCGCTCAGCTTGACGACCTAGTCGCTCACATGACCGAGTATTACTCTAAGAAGGAGAACAGAGAAGCGCATACCTTACGCCACGTGTCCGTTGGGCAAGTGGTGGCGGCGGTGTTCCGACACGACGGCCGCTGGTACCGGGCAAGGGTGCACGACATCAGGCCTAACGAGTTCGATTCATCGCAACAGGTAGCCGACGTGTTCTATCTGGACTACGGCGACAGCGAGTACGTGGCTACGCACGAGCTGTGCGAGCTAAGAGCGGACCTATTAAGGCTGCGGTTCCAGGCCATGGAGTGCTTCCTGGCTGGCGTCCGGCCCGCCAGCGGCGAGGAGGCCGTGTCTCCGTCTGGCCAGCGTTGGGACAAGTGGCATCCACAGGCCGTCGAGAGGTTCGAAGAACTTACCCAGGTAGCGAGGTGGAAGGCCCTGGTCTCCCGGACCTGCACGTACAAGAAGACGGCGACCGCTGAAGGAGAGAAGGACAAAGAGATACCTGGGATCAAACTGTTCGATGTTACTGATGAGGGCGAGCTGGACGTGGGCGCGGTGCTGGTGGCGGAGGGGTGGGCGGTGGCGGGCCCCGCCCCCTCCCCGCGCCCCTCGCCCCCGCGCGGACACACCACGCCCTTCGGAGACCTCAGCAAGTCCAAAGTACTCAGTATGACCGGCGGTGGTGGACGATCATCGTCCGTTCCAAAGGATCACAAAGACGATGGCAGCAATGTGCTCACCGTTGAAGGCGATGACTCCAAAGACAAAGACGGAATAACAGCATCGAAATCACTAGCCTCCGGTCTTGAGAAGTCTGACCGCCATCCGTTATCGATATCGAACTTCGATCTATCGTATCCCGACCCTTCGAGGAACAAACAACTGAACGGCTCCGATGATTTCTTGCACGGCGAGCGGCAAAATATCGATAACGAAATCACTATCGATACATTAGTTCCGCCGTCTCCCCTCTCTAACGCTCCGATACTGTCGAAAACGCTTCAAGACGAATTCAAGGCCAACATGAACCGAATAGATTCGCACCACAGTAATCTCGAAAACCTCGGTAAGTCCGCTTTTGAAAAGTGA

Protein

MSLNTKLALPIALGLSLVTVTAFVAYYVLKRDEEENDNKTVKITKINTIEIHVPKSIVPALIGRNGSNIKDLQKKSGAQIHFKKFTDQDYDVCVVRGRADTTQLAETLIHDFIKQQPTIMSESITVPSWSCGRIIGSGGENVNDISHRSGARVKVESPKSTDKVAEHLVTFRGTKEQIEVAKKLVENCISLERCRREIEQSKRPPRHSSSPPSPCPSPGDRDADADAQETTGPSIEVYVSAVSSPSRFWVQFVGPQVAQLDDLVAHMTEYYSKKENREAHTLRHVSVGQVVAAVFRHDGRWYRARVHDIRPNEFDSSQQVADVFYLDYGDSEYVATHELCELRADLLRLRFQAMECFLAGVRPASGEEAVSPSGQRWDKWHPQAVERFEELTQVARWKALVSRTCTYKKTATAEGEKDKEIPGIKLFDVTDEGELDVGAVLVAEGWAVAGPAPSPRPSPPRGHTTPFGDLSKSKVLSMTGGGGRSSSVPKDHKDDGSNVLTVEGDDSKDKDGITASKSLASGLEKSDRHPLSISNFDLSYPDPSRNKQLNGSDDFLHGERQNIDNEITIDTLVPPSPLSNAPILSKTLQDEFKANMNRIDSHHSNLENLGKSAFEK

Description

Participates in the primary piRNA biogenesis pathway and is required during spermatogenesis to repress transposable elements and prevent their mobilization, which is essential for the germline integrity (PubMed:23970546, PubMed:26919431). The piRNA metabolic process mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins (Siwi or Ago3) and govern the methylation and subsequent repression of transposons (PubMed:23970546, PubMed:26919431). Required for the final steps of primary piRNA biogenesis by participating in the processing of 31-37 nt intermediates into mature piRNAs: acts by recruiting the exonuclease PNLDC1/trimmer to Siwi-bound pre-piRNAs (PubMed:26919431).
Participates in a complex which severs microtubules in an ATP-dependent manner. May act to target the enzymatic subunit of this complex to sites of action such as the centrosome. Microtubule severing may promote rapid reorganization of cellular microtubule arrays and the release of microtubules from the centrosome following nucleation.
Involved in the piwi-interacting RNA (piRNA) metabolic process, which mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins, and governs the methylation and subsequent repression of transposons which is essential for germline integrity (PubMed:21447556, PubMed:29531043). Likely to act by recruiting Piwi proteins such as AGO3 and piwi to the piRNA biogenesis machinery in the nuage (PubMed:21447556, PubMed:29531043). Required for the final steps of primary piRNA biogenesis by participating in the 3' end-trimming of piwi-bound intermediates into mature piRNAs (PubMed:29531043).

Subunit

Interacts with (symmetrically methylated) Siwi (PubMed:23970546, PubMed:26919431). Interacts with (symmetrically methylated) Ago3 (PubMed:23970546). Interacts with PNLDC1/trimmer; interaction takes place on the mitochondrial surface and recruits PNLDC1/trimmer to Siwi-bound pre-piRNAs (PubMed:26919431).
Interacts with KATNA1. This interaction enhances the microtubule binding and severing activity of KATNA1 and also targets this activity to the centrosome.
Interacts (via C-terminus) with AGO3 (via the N-terminal region when symmetrically methylated on arginine residues); this interaction is RNA-independent and may be required for AGO3 localization to the nuage (PubMed:21447556). Interacts (via Tudor domain) with piwi (via N-terminus) (PubMed:21447556, PubMed:29531043). Interacts with tral and me31B (PubMed:21447556).

Similarity

Belongs to the Tdrkh family.
Belongs to the WD repeat KATNB1 family.
Belongs to the XK family.
Belongs to the universal ribosomal protein uS3 family.
Belongs to the mitochondrial carrier (TC 2.A.29) family.

Keywords

3D-structure   Complete proteome   Differentiation   Membrane   Mitochondrion   Mitochondrion outer membrane   Reference proteome   Repeat   RNA-binding   RNA-mediated gene silencing   Spermatogenesis   Transmembrane   Transmembrane helix   Cytoplasm   Nucleus  

Feature

chain  Tudor and KH domain-containing protein homolog

Uniprot

H9JD76   A0A1U6USP0   A0A194QA36   A0A0N1I9W3   A0A212FFX2   A0A2J7QI31   + More
A0A0K8TRZ3   A0A1B0D8U1   J3JXU7   A0A1B6LIZ4   A0A067QZR2   A0A2P8Y4M7   A0A1I8P512   A0A023EU64   Q16K97   A0A1B0A7M9   A0A182GEX1   A0A0K8VNK3   A0A1Y1K1L9   A0A034VWN9   W8B6G7   A0A1Q3FJE6   D3TQM8   B0X0X8   A0A1B0GB97   A0A1B6FKZ6   A0A1B6G1S2   A0A1B6D308   A0A0T6AVE4   A0A1B0CI38   N6UGD8   A0A1A9YIS2   A0A182JJZ3   A0A1B0C1N4   B4KFL0   A0A1A9UNR6   E0VNB8   Q29MJ4   Q9VQ91   A0A1B6ITE1   B3MJA6   A0A1W4UTZ4   B4NW68   B4I2G5   B4G954   A0A0J9TDQ5   A0A182MGW3   A0A182JWC0   B4Q802   U5ENN8   B3N9H5   A0A088AD82   A0A182N8N1   A0A182PXE7   A0A182QH34   A0A1L8DLS9   A0A1J1IKM6   A0A1J1IKG4   A0A1L8DLF5   A0A182I0L2   Q7Q0T6   A0A224XPC3   A0A182XB16   A0A182UIK4   A0A1W4WRY2   A0A182UTS0   A0A182R7S0   A0A182YIK6   A0A182S883   A0A0C9PV82   A0A1S3KBL4   A0A084VQ04   V4A8S8  

Pubmed

19121390    23970546    26919431    26354079    22118469    26369729    + More
22516182    24845553    29403074    24945155    17510324    26483478    28004739    25348373    24495485    20353571    23537049    17994087    18057021    20566863    15632085    23185243    10731132    12537572    12537569    21447556    29531043    17550304    22936249    12364791    14747013    17210077    25244985    24438588    23254933   

EMBL

BABH01036235    BABH01036236    BABH01036237    BABH01036238    KQ459249    KPJ02337.1    + More
KQ460468    KPJ14587.1    AGBW02008752    OWR52635.1    NEVH01013964    PNF28213.1    GDAI01000680    JAI16923.1    AJVK01027734    BT128069    AEE63030.1    GEBQ01016332    JAT23645.1    KK852854    KDR15021.1    PYGN01000938    PSN39206.1    GAPW01000658    JAC12940.1    CH477971    EAT34718.1    JXUM01010565    KQ560311    KXJ83116.1    GDHF01030576    GDHF01024009    GDHF01019077    GDHF01011850    GDHF01001984    GDHF01001474    JAI21738.1    JAI28305.1    JAI33237.1    JAI40464.1    JAI50330.1    JAI50840.1    GEZM01095796    JAV55343.1    GAKP01012430    GAKP01012428    GAKP01012427    GAKP01012426    JAC46522.1    GAMC01012363    JAB94192.1    GFDL01007401    JAV27644.1    EZ423730    ADD20006.1    DS232248    EDS38370.1    CCAG010011564    GECZ01018918    GECZ01011322    JAS50851.1    JAS58447.1    GECZ01019313    GECZ01013395    GECZ01005951    JAS50456.1    JAS56374.1    JAS63818.1    GEDC01017234    JAS20064.1    LJIG01022720    KRT79064.1    AJWK01013029    AJWK01013030    APGK01036313    KB740939    KB631813    ENN77717.1    ERL86377.1    JXJN01024138    CH933807    EDW13125.1    KRG03586.1    KRG03587.1    DS235335    EEB14875.1    CH379060    EAL33700.1    KRT04125.1    AE014134    AY058408    GECU01028454    GECU01027109    GECU01017520    JAS79252.1    JAS80597.1    JAS90186.1    CH902620    EDV31316.1    KPU73314.1    KPU73315.1    CM000157    EDW87348.1    KRJ97127.1    KRJ97128.1    CH480820    EDW53960.1    CH479180    EDW28884.1    CM002910    KMY87613.1    KMY87614.1    KMY87615.1    KMY87616.1    AXCM01004445    CM000361    EDX03424.1    GANO01000519    JAB59352.1    CH954177    EDV57432.1    KQS69990.1    AXCN02001856    GFDF01006784    JAV07300.1    CVRI01000054    CRL00728.1    CRL00727.1    GFDF01006785    JAV07299.1    APCN01005219    AAAB01008980    EAA13859.4    GFTR01006413    JAW10013.1    GBYB01005303    JAG75070.1    ATLV01015102    KE525002    KFB40048.1    KB202544    ESO89711.1   

Proteomes

UP000005204    UP000053268    UP000053240    UP000007151    UP000235965    UP000092462    + More
UP000027135    UP000245037    UP000095300    UP000008820    UP000092445    UP000069940    UP000249989    UP000002320    UP000092444    UP000092461    UP000019118    UP000030742    UP000092443    UP000075880    UP000092460    UP000009192    UP000078200    UP000009046    UP000001819    UP000000803    UP000007801    UP000192221    UP000002282    UP000001292    UP000008744    UP000075883    UP000075881    UP000000304    UP000008711    UP000005203    UP000075884    UP000075885    UP000075886    UP000183832    UP000075840    UP000007062    UP000076407    UP000075902    UP000192223    UP000075903    UP000075900    UP000076408    UP000075901    UP000085678    UP000030765    UP000030746   

PRIDE

H9JD76    Q9VQ91   

Pfam

PF00013   KH_1        + More
PF00567   TUDOR
PF13925   Katanin_con80
PF12894   ANAPC4_WD40
PF09815   XK-related
PF00400   WD40
PF00189   Ribosomal_S3_C
PF07650   KH_2
PF11901   DUF3421
PF00153   Mito_carr

Interpro

IPR004088   KH_dom_type_1        + More
IPR035437   SNase_OB-fold_sf       
IPR036612   KH_dom_type_1_sf       
IPR002999   Tudor       
IPR004087   KH_dom       
IPR001680   WD40_repeat       
IPR024977   Apc4_WD40_dom       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR019775   WD40_repeat_CS       
IPR020472   G-protein_beta_WD-40_rep       
IPR028021   Katanin_C-terminal       
IPR018629   XK-rel       
IPR017986   WD40_repeat_dom       
IPR036322   WD40_repeat_dom_sf       
IPR026962   Katanin_bsu1       
IPR005703   Ribosomal_S3_euk/arc       
IPR036419   Ribosomal_S3_C_sf       
IPR001351   Ribosomal_S3_C       
IPR004044   KH_dom_type_2       
IPR015946   KH_dom-like_a/b       
IPR018280   Ribosomal_S3_CS       
IPR009019   KH_sf_prok-type       
IPR024518   DUF3421       
IPR006616   DM9_repeat       
IPR023395   Mt_carrier_dom_sf       
IPR018108   Mitochondrial_sb/sol_carrier       

SUPFAM

SSF54791   SSF54791        + More
SSF50978   SSF50978       
SSF54821   SSF54821       
SSF54814   SSF54814       
SSF103506   SSF103506       

Gene 3D

2.40.50.90     3.30.1370.10     2.130.10.10     3.30.1140.32     3.30.300.20     1.50.40.10    

ProteinModelPortal

H9JD76   A0A1U6USP0   A0A194QA36   A0A0N1I9W3   A0A212FFX2   A0A2J7QI31   + More
A0A0K8TRZ3   A0A1B0D8U1   J3JXU7   A0A1B6LIZ4   A0A067QZR2   A0A2P8Y4M7   A0A1I8P512   A0A023EU64   Q16K97   A0A1B0A7M9   A0A182GEX1   A0A0K8VNK3   A0A1Y1K1L9   A0A034VWN9   W8B6G7   A0A1Q3FJE6   D3TQM8   B0X0X8   A0A1B0GB97   A0A1B6FKZ6   A0A1B6G1S2   A0A1B6D308   A0A0T6AVE4   A0A1B0CI38   N6UGD8   A0A1A9YIS2   A0A182JJZ3   A0A1B0C1N4   B4KFL0   A0A1A9UNR6   E0VNB8   Q29MJ4   Q9VQ91   A0A1B6ITE1   B3MJA6   A0A1W4UTZ4   B4NW68   B4I2G5   B4G954   A0A0J9TDQ5   A0A182MGW3   A0A182JWC0   B4Q802   U5ENN8   B3N9H5   A0A088AD82   A0A182N8N1   A0A182PXE7   A0A182QH34   A0A1L8DLS9   A0A1J1IKM6   A0A1J1IKG4   A0A1L8DLF5   A0A182I0L2   Q7Q0T6   A0A224XPC3   A0A182XB16   A0A182UIK4   A0A1W4WRY2   A0A182UTS0   A0A182R7S0   A0A182YIK6   A0A182S883   A0A0C9PV82   A0A1S3KBL4   A0A084VQ04   V4A8S8  

PDB

5VY1     E-value=5.09747e-127,     Score=1165

KEGG

101741153    K18406 tudor domain-containing protein 2 | (RefSeq) tudor and KH domain-containing protein

GO

GO:0003723   GO:0030154   GO:0007283   GO:0005741   GO:0016021   GO:0031047   GO:1990511   GO:0016301   GO:0005874   GO:0008017   GO:0005813   GO:0000922   GO:0007049   GO:0051301   GO:0051013   GO:0008352   GO:0015935   GO:0006412   GO:0003735   GO:0070895   GO:0047485   GO:1903829   GO:0043186   GO:0005634   GO:0032991   GO:0000932   GO:0022857   GO:0003676   GO:0006303   GO:0004003   GO:0045901   GO:0045905   GO:0006334   GO:0003779  

Subcellular location

Mitochondrion outer membrane   Localizes to the outer surface of mitochondria.   With evidence from 5 publications.
Cytoplasm   Predominantly cytoplasmic. Localized to the interphase centrosome and mitotic spindle poles.   With evidence from 1 publications.
Cytoskeleton   Predominantly cytoplasmic. Localized to the interphase centrosome and mitotic spindle poles.   With evidence from 1 publications.
Microtubule organizing center   Predominantly cytoplasmic. Localized to the interphase centrosome and mitotic spindle poles.   With evidence from 1 publications.
Centrosome   Predominantly cytoplasmic. Localized to the interphase centrosome and mitotic spindle poles.   With evidence from 1 publications.
Spindle pole   Predominantly cytoplasmic. Localized to the interphase centrosome and mitotic spindle poles.   With evidence from 1 publications.
Spindle   Predominantly cytoplasmic. Localized to the interphase centrosome and mitotic spindle poles.   With evidence from 1 publications.
Membrane   Predominantly cytoplasmic. Localized to the interphase centrosome and mitotic spindle poles.   With evidence from 1 publications.
Nucleus   Component of the meiotic nuage, also named P granule, a germ-cell-specific organelle required to repress transposon activity during meiosis. Expressed in the cytoplasm of germline stem cells, cyst cells, nurse cells and oocytes, with strong accumulation in region IIb germline cysts in the germarium. In post-germarium egg chambers accumulates in the perinuclear loci that appear to be the nuage.   With evidence from 7 publications.
P-body   Component of the meiotic nuage, also named P granule, a germ-cell-specific organelle required to repress transposon activity during meiosis. Expressed in the cytoplasm of germline stem cells, cyst cells, nurse cells and oocytes, with strong accumulation in region IIb germline cysts in the germarium. In post-germarium egg chambers accumulates in the perinuclear loci that appear to be the nuage.   With evidence from 7 publications.

Length:

616

Number of predicted TMHs:

1

Exp number of AAs in TMHs:

22.76228

Exp number, first 60 AAs:

22.76124

Total prob of N-in:

0.99496

POSSIBLE N-term signal

sequence

inside

1  -  6

TMhelix

7  -  29

outside

30  -  616

 

 

Pi

273.970206

Theta

174.082883

Tajima's D

1.598788

CLR

0.579402

CSRT

0.807609619519024

Interpretation

Uncertain