Gene

KWMTBOMO01129  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA009430

Annotation

F-actin_capping_protein_beta_subunit_[Bombyx_mori]

Location

Bomo_Chr3(+):2872917-2877800      View in EpiBrowser

Full name

F-actin-capping protein subunit beta       + More
F-actin-capping protein subunit beta isoforms 1 and 2      

Alternative Name

Beta-actinin subunit II
CapZ 36/32
CapZ B1 and B2
CapZ beta

Location in the cell

Nuclear   Reliability : 3.008

CDS

ATGAGTGACCAACAAATGGATTGTGCACTGGACTTGATGCGGAGGCTGCCCCCTCAGCAGATCGAAAAGAATTTAACAGATTTGATAGATCTCGTTCCGAGTATGTGTGACGACCTATTATCATCAGTAGATCAGCCTCTAAAGATTGCTCAGGATCGTAGCAACGGGAAAGACTATTTATTATGCGATTACAATCGCGACGGTGACTCCTATAGGTCTCCTTGGTCGAATACTTACGACCCACCATTAGATGATGGCTCCATGCCCTCTGAACGCTTGAGAAAACTAGAAATAGATGCCAACCTCGCCTTTGATCAATATCGAGAGATGTACTTTGAAGGTGGCGTTAGCTCAGTCTACCTTTGGGATATGGATCATGGCTTTGCAGGAGTAATATTAATCAAGAAAGCTGGAGATGGTTCCCAAAAGATCAAAGGATGCTGGGATTCAATCCACGTAGTGGAGGTGATCGAGAAGAGTTCAGGACGCAATGCTCACTACAAGTTGACCTCGACTGCAATGTTGTGGCTTCAGACTAATAAAGAAAGCAGCGGCACGATGAACCTTGGAGGCAGTTTGACTAGACAGGCAGAACAAGACTCGACAGTAAGTGATGTGACTCCGCACATTGCAAATATTGGGCGCATGGTGGAAGACATGGAAAATAAGATCAGAAACACACTTAACGACATTTATTTTGGTAAAACAAAAGATATAGTGAGCGGGCTGAGGTCAGTGATCCCGGCGGACGTGGCGCGCCGCACCGCCGCGCTGCAGCACGACCTCGCGCTCGCCCTGCAGCGCCGCCACGTGCAGCGCGACGACTGA

Protein

MSDQQMDCALDLMRRLPPQQIEKNLTDLIDLVPSMCDDLLSSVDQPLKIAQDRSNGKDYLLCDYNRDGDSYRSPWSNTYDPPLDDGSMPSERLRKLEIDANLAFDQYREMYFEGGVSSVYLWDMDHGFAGVILIKKAGDGSQKIKGCWDSIHVVEVIEKSSGRNAHYKLTSTAMLWLQTNKESSGTMNLGGSLTRQAEQDSTVSDVTPHIANIGRMVEDMENKIRNTLNDIYFGKTKDIVSGLRSVIPADVARRTAALQHDLALALQRRHVQRDD

Description

F-actin-capping proteins bind in a Ca(2+)-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends. Unlike other capping proteins (such as gelsolin and severin), these proteins do not sever actin filaments.
F-actin-capping proteins bind in a Ca(2+)-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends. Unlike other capping proteins (such as gelsolin and severin), these proteins do not sever actin filaments. Isoform 3 may play a role in spermatogenesis. Alternatively, may play a role in later maturation steps such as capacitation and fertilization which involve changes of membrane domains. Plays a role in the regulation of cell morphology and cytoskeletal organization (By similarity).
F-actin-capping proteins bind in a Ca(2+)-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends. Unlike other capping proteins (such as gelsolin and severin), these proteins do not sever actin filaments. Plays a role in the regulation of cell morphology and cytoskeletal organization.
F-actin-capping proteins bind in a Ca(2+)-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends. Unlike other capping proteins (such as gelsolin and severin), these proteins do not sever actin filaments. Plays a role in the regulation of cell morphology and cytoskeletal organization (By similarity).

Subunit

Heterodimer of an alpha and a beta subunit.
Heterodimer of an alpha and a beta subunit. Component of the WASH complex (By similarity). Isoform 2 also is a component of dynactin complex from brain, which contains the actin-related protein ARP1.
Heterodimer of an alpha and a beta subunit. Interacts with ARHGAP17 and RCSD1/CAPZIP. Component of the WASH complex, composed of F-actin-capping protein subunit alpha (CAPZA1, CAPZA2 or CAPZA3), F-actin-capping protein subunit beta (CAPZB), WASHC1, WASHC2, WASHC3, WASHC4 and WASHC5. Isoform 2 also is a component of dynactin complex from brain, which contains the actin-related protein ARP1. Interacts with ACTG1. Directly interacts with CRAD/KIAA1211; this interaction decreases binding to actin (By similarity).
Heterodimer of an alpha and a beta subunit. Interacts with ARHGAP17 (PubMed:16678097). Interaction with RCSD1/CAPZIP (PubMed:15850461). Component of the WASH complex, composed of F-actin-capping protein subunit alpha (CAPZA1, CAPZA2 or CAPZA3), F-actin-capping protein subunit beta (CAPZB), WASH (WASHC1, WASH2P, WASH3P, WASH4P, WASH5P or WASH6P), WASHC2 (WASHC2A or WASHC2C), WASHC3, WASHC4 and WASHC5 (PubMed:19922875). Interacts with ACTG1 (PubMed:28493397). Directly interacts with CRAD/KIAA1211; this interaction decreases binding to actin (PubMed:30361697).
Heterodimer of an alpha and a beta subunit. Interacts with ARHGAP17 and RCSD1/CAPZIP. Component of the WASH complex, composed of F-actin-capping protein subunit alpha (CAPZA1, CAPZA2 or CAPZA3), F-actin-capping protein subunit beta (CAPZB), WASHC1, WASHC2, WASHC3, WASHC4 and WASHC5. Interacts with ACTG1. Directly interacts with CRAD/KIAA1211; this interaction decreases binding to actin (By similarity).

Similarity

Belongs to the F-actin-capping protein beta subunit family.

Keywords

3D-structure   Acetylation   Actin capping   Actin-binding   Alternative splicing   Complete proteome   Cytoplasm   Cytoskeleton   Direct protein sequencing   Reference proteome   Phosphoprotein   Coiled coil  

Feature

chain  F-actin-capping protein subunit beta
splice variant  In isoform 2.

Uniprot

H9JIS9   Q1HPW1   A0A1E1WJ21   A0A194R544   A0A194QBF5   A0A2A4JDG3   + More
A0A212ESG1   A0A1B6E0M4   A0A2P8Y6P0   A0A2J7R613   A0A067RE83   E2AEJ3   K7IUS4   A0A0C9REI9   A0A026W7J4   A0A2A3ERK9   V9IH62   A0A088ALS0   E9IJD6   A0A195FLK4   A0A1S3HLK8   A0A195CQT2   T1ISE5   A0A232F0D8   A0A0M9A506   A0A0P4WB08   A0A1J1IW60   A0A182QPP8   U5ELN2   A0A195EN29   F4WRT9   A0A195BUV7   E2BT35   A0A158NEM1   A0A151XIQ7   A0A3L8DAS2   A0A2P2HX07   A0A182RBT4   A0A1Y1LI08   T1PER4   A0A182SZ68   A0A0K8TTY9   A0A1B6JAJ8   A0A182J5C2   A0A182W9W2   A0A1S3DD83   T1E7W6   A0A2M3Z683   A0A2M4AJV2   W5J6I8   A0A336M726   T1E2V4   A0A1L8E5A9   A0A0L7RHI0   A0A1L8EFX0   A0A341BUW6   A0A2Y9LQW2   A0A1Q3FF96   B0WTE9   K7G5K9   A0A182UQT7   A0A182WTF0   A0A182L299   A0A1S4GX64   P14315-2   A0A1V4KR17   B5G462   A0PFK4   A0A182JWA5   I7GUD2   A0A154PIW7   A0A2Y9DME8   A0A1B0CWU4   P47757-2   P47756-2   P79136-2   A0A1S3GLX3   Q923G3   A0A341BRY2   A0A2U4A086   A0A2Y9ELP0   A0A2Y9GKN2   A0A2J8T2D9   A0A2Y9K8L6   A0A2Y9LG10   A0A2U3ZCI2   M3YXJ4   A9XFX6   F7H329   K7AHH7   A0A384MR50   Q5XI32   Q5R507   D2JYW3   A0A286XEV3   A0A310SMK6   E0VDY6   A0A1A9W1R3   A7RU18   A0A0B8RZE9  

Pubmed

19121390    26354079    22118469    29403074    24845553    20798317    + More
20075255    24508170    21282665    28648823    21719571    21347285    30249741    28004739    25315136    26369729    20920257    23761445    24330624    17381049    20966253    12364791    2745461    7929588    2341404    17018643    22951807    19341723    19468303    17242355    21183079    23806337    7665558    16710414    15489334    12665801    15850461    16678097    19413330    19922875    19608861    21834987    21269460    21406692    22223895    22814378    23186163    24275569    25944712    28493397    30361697    9184090    10349636    11042159    11076861    11217851    12466851    12040188    16141073    17939027    24792893    29420470    30723633    25243066    19343716    22673903    21993624    20566863    17615350    25476704   

EMBL

BABH01041409    DQ443291    ABF51380.1    GDQN01004072    JAT86982.1    KQ460685    + More
KPJ12802.1    KQ459249    KPJ02320.1    NWSH01001909    PCG69718.1    AGBW02012799    OWR44420.1    GEDC01031115    GEDC01016116    GEDC01015627    GEDC01005871    GEDC01003145    GEDC01002078    GEDC01000542    JAS06183.1    JAS21182.1    JAS21671.1    JAS31427.1    JAS34153.1    JAS35220.1    JAS36756.1    PYGN01000864    PSN39920.1    NEVH01006983    PNF36279.1    KK852561    KDR21348.1    GL438862    EFN68150.1    AAZX01005919    GBYB01006750    JAG76517.1    KK107356    EZA52025.1    KZ288191    PBC34433.1    JR044042    AEY59836.1    GL763764    EFZ19314.1    KQ981490    KYN41216.1    KQ977381    KYN03103.1    JH431430    NNAY01001398    OXU24121.1    KQ435756    KOX75989.1    GDRN01056479    JAI65818.1    CVRI01000058    CRL02777.1    AXCN02000864    GANO01001334    JAB58537.1    KQ978625    KYN29576.1    GL888292    EGI63096.1    KQ976401    KYM92367.1    GL450325    EFN81165.1    ADTU01013498    KQ982080    KYQ60303.1    QOIP01000010    RLU17434.1    IACF01000392    LAB66170.1    GEZM01057027    JAV72498.1    KA647272    AFP61901.1    GDAI01000015    JAI17588.1    GECU01011571    JAS96135.1    GAMD01002692    JAA98898.1    GGFM01003253    MBW24004.1    GGFK01007742    MBW41063.1    ADMH02002133    GGFL01004378    ETN58455.1    MBW68556.1    UFQS01000618    UFQT01000618    SSX05461.1    SSX25820.1    GALA01000950    JAA93902.1    GFDF01000196    JAV13888.1    KQ414592    KOC70186.1    GFDG01001300    JAV17499.1    GFDL01008821    JAV26224.1    DS232085    EDS34387.1    AGCU01032938    AGCU01032939    AGCU01032940    AGCU01032941    AGCU01032942    AGCU01032943    AGCU01032944    AGCU01032945    AGCU01032946    AGCU01032947    AAAB01008964    J04959    U07826    LSYS01002427    OPJ86237.1    DQ217035    DQ217036    ACH46073.1    AM410993    CAL69434.1    AB710463    BAM34023.1    KQ434905    KZC11258.1    AJWK01032871    U10406    U10407    FJ692320    AL807811    U03271    BT019470    BT019471    AL035413    AL359199    AL445163    CH471134    BC024601    BC107752    BC109241    BC109242    Z85980    Y10372    BC102613    BC002053    AK156778    AK168738    CH466615    AAH02053.1    BAE33851.1    BAE40579.1    EDL13298.1    NDHI03003525    PNJ27188.1    AEYP01008404    AEYP01008405    AEYP01008406    AEYP01008407    AEYP01008408    AEYP01008409    AEYP01008410    AEMK02000045    EF202986    EF202989    JX569751    JX966416    DQIR01151511    DQIR01207860    DQIR01250994    DQIR01255040    DQIR01297729    DQIR01312228    ABQ96220.1    AGO58802.1    HDB06988.1    GAMT01005124    GAMS01008249    GAMR01003909    GAMQ01001417    GAMP01006171    JAB06737.1    JAB14887.1    JAB30023.1    JAB40434.1    JAB46584.1    GABF01004689    NBAG03000373    JAA17456.1    PNI33496.1    GQ900984    ADO22501.1    BC083861    CR861078    GU165833    ACZ57956.1    AAKN02028758    AAKN02028759    KQ761155    OAD58132.1    DS235088    EEB11592.1    DS469539    EDO44936.1    GBSH01001031    GBSH01000547    JAG68478.1   

Proteomes

UP000005204    UP000053240    UP000053268    UP000218220    UP000007151    UP000245037    + More
UP000235965    UP000027135    UP000000311    UP000002358    UP000053097    UP000242457    UP000005203    UP000078541    UP000085678    UP000078542    UP000215335    UP000053105    UP000183832    UP000075886    UP000078492    UP000007755    UP000078540    UP000008237    UP000005205    UP000075809    UP000279307    UP000075900    UP000095301    UP000075901    UP000075880    UP000075920    UP000079169    UP000000673    UP000053825    UP000252040    UP000248483    UP000002320    UP000007267    UP000075903    UP000076407    UP000075882    UP000000539    UP000190648    UP000075881    UP000076502    UP000248480    UP000092461    UP000000589    UP000005640    UP000009136    UP000081671    UP000245320    UP000248484    UP000248481    UP000248482    UP000245340    UP000000715    UP000008227    UP000008225    UP000002494    UP000001595    UP000005447    UP000009046    UP000091820    UP000001593   

PRIDE

H9JIS9    Q1HPW1    P14315    A0PFK4    P47757    P47756    + More
P79136    Q5XI32    Q5R507    D2JYW3   

Pfam

PF01115   F_actin_cap_B

Interpro

IPR042276   CapZ_alpha/beta_2        + More
IPR001698   CAPZB       
IPR019771   F-actin_capping_bsu_CS       
IPR037282   CapZ_alpha/beta       

SUPFAM

SSF90096   SSF90096       

Gene 3D

2.40.160.80    

ProteinModelPortal

H9JIS9   Q1HPW1   A0A1E1WJ21   A0A194R544   A0A194QBF5   A0A2A4JDG3   + More
A0A212ESG1   A0A1B6E0M4   A0A2P8Y6P0   A0A2J7R613   A0A067RE83   E2AEJ3   K7IUS4   A0A0C9REI9   A0A026W7J4   A0A2A3ERK9   V9IH62   A0A088ALS0   E9IJD6   A0A195FLK4   A0A1S3HLK8   A0A195CQT2   T1ISE5   A0A232F0D8   A0A0M9A506   A0A0P4WB08   A0A1J1IW60   A0A182QPP8   U5ELN2   A0A195EN29   F4WRT9   A0A195BUV7   E2BT35   A0A158NEM1   A0A151XIQ7   A0A3L8DAS2   A0A2P2HX07   A0A182RBT4   A0A1Y1LI08   T1PER4   A0A182SZ68   A0A0K8TTY9   A0A1B6JAJ8   A0A182J5C2   A0A182W9W2   A0A1S3DD83   T1E7W6   A0A2M3Z683   A0A2M4AJV2   W5J6I8   A0A336M726   T1E2V4   A0A1L8E5A9   A0A0L7RHI0   A0A1L8EFX0   A0A341BUW6   A0A2Y9LQW2   A0A1Q3FF96   B0WTE9   K7G5K9   A0A182UQT7   A0A182WTF0   A0A182L299   A0A1S4GX64   P14315-2   A0A1V4KR17   B5G462   A0PFK4   A0A182JWA5   I7GUD2   A0A154PIW7   A0A2Y9DME8   A0A1B0CWU4   P47757-2   P47756-2   P79136-2   A0A1S3GLX3   Q923G3   A0A341BRY2   A0A2U4A086   A0A2Y9ELP0   A0A2Y9GKN2   A0A2J8T2D9   A0A2Y9K8L6   A0A2Y9LG10   A0A2U3ZCI2   M3YXJ4   A9XFX6   F7H329   K7AHH7   A0A384MR50   Q5XI32   Q5R507   D2JYW3   A0A286XEV3   A0A310SMK6   E0VDY6   A0A1A9W1R3   A7RU18   A0A0B8RZE9  

PDB

6F3A     E-value=6.8783e-123,     Score=1126

KEGG

732972    K10365 capping protein (actin filament) muscle Z-line, beta | (RefSeq) F-actin capping protein beta

PATHWAY

04144    Endocytosis - Bombyx mori (domestic silkworm)

GO

GO:0003779   GO:0005737   GO:0030036   GO:0008290   GO:0051016   GO:0098686   GO:0030018   GO:0030032   GO:0005829   GO:0098685   GO:0022604   GO:0051015   GO:0016020   GO:0030863   GO:0005903   GO:0010591   GO:0030027   GO:0007010   GO:0014069   GO:0051490   GO:0000902   GO:0031115   GO:0014704   GO:0031175   GO:0043025   GO:0043197   GO:0048747   GO:0032279   GO:0033150   GO:0048487   GO:0090036   GO:0071203   GO:0030030   GO:0006888   GO:0015629   GO:0019886   GO:0070062   GO:0045296   GO:0007596   GO:0005856   GO:0030017   GO:0008270   GO:0005634   GO:0006334   GO:0016021  

PANTHER

PTHR10619  

Subcellular location

  
Cytoplasm   In cardiac muscle, isoform 2 is located at sarcomere intercalated disks.   With evidence from 5 publications.
Myofibril   In cardiac muscle, isoform 2 is located at sarcomere intercalated disks.   With evidence from 5 publications.
Sarcomere   In cardiac muscle, isoform 2 is located at sarcomere intercalated disks.   With evidence from 5 publications.
I band   In cardiac muscle, isoform 2 is located at sarcomere intercalated disks.   With evidence from 5 publications.
Cytoskeleton   In cardiac muscle, isoform 2 is located at sarcomere intercalated disks.   With evidence from 5 publications.
Z line   In cardiac muscle, isoform 1 is located at Z-disks of sarcomeres while isoform 2 is enriched at intercalated disks.   With evidence from 2 publications.

Length:

275

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.01302

Exp number, first 60 AAs:

0

Total prob of N-in:

0.06481

outside

1  -  275

 

 

Pi

21.046474

Theta

16.613109

Tajima's D

-1.216345

CLR

2.950722

CSRT

0.0996450177491125

Interpretation

Uncertain