SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01128
Pre Gene Modal
BGIBMGA009429
Annotation
PREDICTED:_uncharacterized_protein_LOC101743030_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.201 Nuclear   Reliability : 1.569
 

Sequence

CDS
ATGCATTTCAGACTTCAATCGAGGCTCATTGAAGAGTTGCTGCCCGGTCGCCCACTGGAGAACCCACGGCACCCTAAGAGGGCAAGGGTGCTCCCTCCTAAGGTCGGGAAACACCCAGGATCGGAGTTCTGGAGACCGGACCTTCCAACTCCGGACCTGGATGCTTCGGTGTTATCACCTGCCCTATATTTACAATGTGGGCCTGGGAGTAGCCGGGCTAGCACCCCGGTCATGGAGTGGCCCGGGACTAGCGGGGCCAGCACTCCGGTTATGGAGCGGCCCGGGCCTAGCGGGGCCAGCACTCCGGTTATGGAGCGGCCCGGGCCTAGCGGGGCCAGCACCTCGGCTACCGAGCGGCGTGTTATCCCTTCGTCCTCTCGACCTCCTCGTCCTCTTCGCGAAGACGAAATTATAGCACTGCTGAATTACGGCAGCGAAGAGGACTCTGAGGGAGAGGACGAAGAAATTCTGCAGCCGTCGCTGGTTCCCCGGGCGACCAGGATGTGGCTGGACGAAGAGGATGAGGAAGTTGAAGAGGAAGCGGAGAGGCTTAATATTAATTTGGAGTGGCCTCGACCTCCTCAACCTCTTCGTCCATCCGCATCTGCTCCAGTGGACGTCTCACCGACGTCCACATTAGATCCTATATATAAGTTTAAATTCGAATGGAGAAATATCTCAATGCCTCAAATAGAACCTCATTTAAGGCGAGAGCTTTTCTCCGAAATTATTGGTCCATCGGTTTCTTTCGCGACTCCGTACGATGCATTTATTGCCATATGGGATCGTGAAATTATGCAAGTCATAGTCACGGAAACCAACATTTATGCACAGCAGGTGGCAACGGCCATGTTGGCGAGTGGGACGATCGGCCCTCATAGTCGGATTACTCGATGGCAAGATACGAATGTAGACGAACTTTACACGTATTTTGCCATCGTTCTGGCTATGGGGGTGGTCGTCAAAAGCTGCTTAGAAGATTATTGGCATACCGCTCGGGATATTTTTTATACTCCGGGTTTCGCAGCGGATATGTCATATGACCGTTTTCAGCTGCTGTCCAAATGCCTCCATTTCAATAATAATGAGTATTGCGACATTACAATGTTGACACGACGCCAGGCCAAGCTCTACAAAATTCAGCCCATAGTAGACCATTTAAATACAAAATTTTCGGAGCTGTACAATTTGAGTCGAAATTTAGCAGTGGATGAGAGTTTGACGATGTGGAAGGGCTGGCTTGATATAAACCAGTTCATTCCTAACAAGGCAGCGACAATTGGGATCAAAACTTATGAAGTGTGTGAATCGCGGAGTGGTTACCTGTGGCGGTTTGAAGTTCACGCAGGCCATGACATCTCGACTTCACAGGACGATCCAATTTCTGGCACAGTACCAGCTCTCGTGCTCAGACTTTTAAGTGGTCTTGAGCATAAAGGGCACACAATATGGATGGATAATTTTTATAACTCTCCAGCGCTAGCCCGAGAACTTAAGACCCGCGGCTTTGACTGCGTGGGCACACTGCGGACTAACCGACAATTTGTGCCGTACGAATTGACGTCCCTTACAAAAAAGGATATGACAGTCGGTCAAGTGACGGGATGCACCTCGGGAGATGTGGATCTTTTGGTGTGGAAAGATAAAAACCGGGTGGCTTTTATTTCCACATACCATGGTCTCGCATCTGTTAGGTTTGAGGAAAGACTGAAGCCGACTGTCGCTTGCGATTATAACGTTTGTATGGGCGGAGTAGACCGCAAAGACCAGCAGCTCGCAATGTACCCCATAGAAAGAAGAAGGACAAGAGTTTGGTACAAGAAGTTGTTTAGAAGGGTGTCTTGA
Protein
MHFRLQSRLIEELLPGRPLENPRHPKRARVLPPKVGKHPGSEFWRPDLPTPDLDASVLSPALYLQCGPGSSRASTPVMEWPGTSGASTPVMERPGPSGASTPVMERPGPSGASTSATERRVIPSSSRPPRPLREDEIIALLNYGSEEDSEGEDEEILQPSLVPRATRMWLDEEDEEVEEEAERLNINLEWPRPPQPLRPSASAPVDVSPTSTLDPIYKFKFEWRNISMPQIEPHLRRELFSEIIGPSVSFATPYDAFIAIWDREIMQVIVTETNIYAQQVATAMLASGTIGPHSRITRWQDTNVDELYTYFAIVLAMGVVVKSCLEDYWHTARDIFYTPGFAADMSYDRFQLLSKCLHFNNNEYCDITMLTRRQAKLYKIQPIVDHLNTKFSELYNLSRNLAVDESLTMWKGWLDINQFIPNKAATIGIKTYEVCESRSGYLWRFEVHAGHDISTSQDDPISGTVPALVLRLLSGLEHKGHTIWMDNFYNSPALARELKTRGFDCVGTLRTNRQFVPYELTSLTKKDMTVGQVTGCTSGDVDLLVWKDKNRVAFISTYHGLASVRFEERLKPTVACDYNVCMGGVDRKDQQLAMYPIERRRTRVWYKKLFRRVS

Summary

Pfam
PF13843   DDE_Tnp_1_7        + More
PF13842   Tnp_zf-ribbon_2
Interpro
IPR029526   PGBD        + More
IPR032718   PGBD4_C_Znf-ribbon       
PDB
1DEQ     E-value=0.0854143,     Score=85

Ontologies

GO

Topology

Length:
614
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.21188
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00438
outside
1  -  614
 
 

Population Genetic Test Statistics

Pi
217.461654
Theta
184.637402
Tajima's D
0.539957
CLR
0.000158
CSRT
0.522973851307435
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号