SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01120
Annotation
PREDICTED:_uncharacterized_protein_LOC105385054_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.94
 

Sequence

CDS
ATGTTCCTCACAGATTGTGATCTATGGGACTGTGTAAGTACAGACACACTTGATACTCCTGAATTTAAAAAGAGAGATAGTAAAGCAAGAGCAAAAATATGTCTACTCTTGGAAGAAAACATTTTCCCAATTGTTACCGGTGCCGTAACGGCAAAACAAACATGGGATGCGTTAGAAAAGGCCTACGCCGATGGCGGACTGTTGAGACGACTCACTTTATTAAGAAAATTATTTAATTTGAAATTATCATGTTTCGTAAATATCGAAGCATACATCAATGAAGTGCAGGCGACAAGTCAGGCTTTACAGCGAATCAAATCAGGACTGGATGATGAATTCATTGGGATCATAATGTTAGCTGGGTTGACCGAGGAATACAATCCTTTGGTGATGGCGTTGGAACATTCTGGAAGGAAATTAACTTCAGAAGCGGTCATATCTGCTCTAATGAAGGAAGGACAGCTCAAGCAGCCGGCAGTTGAAATGGATTCTGTGTTAGTGTCTAATAACGAAAAACCTAGTAGTAGTACGAAAAAGGCAATAATATGTCATTTTTGTAAAAAGAAAGGTCATTTTAAATGGCAATGTAAATTTTATAAAGATAGGGATAAGAAAGGTAATGCAAATGTATGCGTAGCTCAAAAGGAGACTAATGATTTTATTACCTTACTCTCTAATATGGGAAAGTCGAGAAATTGGATTATAGATTCTGGGGCAACATCTCATATGACATCATCAGATAATGTTTTAGTAAATGCTAAAGGTGGTTACCGGAAGTATATAACTACAGCTAATAATGAGAAAATATTATCTAAGGTAAAGGGTGATGTATTGATGCCTAATTATAAGTTAAAGTTTGAGAATGTTTTGTACATACCAGATTTGATAACAATTTACTTTCTGTCTCCAACCATGGCTATCTCAGACAAAGTTCCTGAAGAAGTGTGGTCAGGTGAACGAGTGGATATCACCAATCTCAAGGTTTTTGGTAGTAAAGCTCAAGTACTCATTAAGGGAAACAATAGAAGGAAATTTGATTCAAAGTCAAGAGAATTAATTATGATTGGCTATAGTTTGAATCAAAAAGGCTATCGTTTCGTGGATATTAAGAATCCAACTCGGCTAATAATCGCTCGGGACGCAGTATTTTTTGAAAATGTTCAGAATTATGGCAAAGAGACCATTCATCTGGAGTCGGTGGATAGTATTCAGAACAATGAAATTTCAATAAATAGTAATTATCATCCGGTTATGTCTCAGGTTCCTGTCCATATAGGAGATCCTGATGCAGTGGGGGAATTGGAAATGAATACTCCTGATCCAACCACTTCTACAAATGAATCAACCACCTCTACAAACGAACGTCGTTATTCAAAGAGGATTAGACGTCCCAAAATACAAGAAGATATGATCTATAATTTTTTGATTACCGAGGGATCAGATCCTAAGTCAGTTGAGGACACATTGGAACGTTCGGATCGAGAGTTATGGCACACAGCCATGTTAGATGGATACAATTCGCTGATGCAAAACAAAAACAGTGAACAGAATTAA
Protein
MFLTDCDLWDCVSTDTLDTPEFKKRDSKARAKICLLLEENIFPIVTGAVTAKQTWDALEKAYADGGLLRRLTLLRKLFNLKLSCFVNIEAYINEVQATSQALQRIKSGLDDEFIGIIMLAGLTEEYNPLVMALEHSGRKLTSEAVISALMKEGQLKQPAVEMDSVLVSNNEKPSSSTKKAIICHFCKKKGHFKWQCKFYKDRDKKGNANVCVAQKETNDFITLLSNMGKSRNWIIDSGATSHMTSSDNVLVNAKGGYRKYITTANNEKILSKVKGDVLMPNYKLKFENVLYIPDLITIYFLSPTMAISDKVPEEVWSGERVDITNLKVFGSKAQVLIKGNNRRKFDSKSRELIMIGYSLNQKGYRFVDIKNPTRLIIARDAVFFENVQNYGKETIHLESVDSIQNNEISINSNYHPVMSQVPVHIGDPDAVGELEMNTPDPTTSTNESTTSTNERRYSKRIRRPKIQEDMIYNFLITEGSDPKSVEDTLERSDRELWHTAMLDGYNSLMQNKNSEQN

Summary

Pfam
PF13976   gag_pre-integrs        + More
PF00665   rve
PF07727   RVT_2
PF13961   DUF4219
Interpro
IPR013103   RVT_2        + More
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR036397   RNaseH_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
517
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0532100000000001
Exp number, first 60 AAs:
0.03351
Total prob of N-in:
0.00337
outside
1  -  517
 
 

Population Genetic Test Statistics

Pi
277.350594
Theta
162.372548
Tajima's D
2.483373
CLR
0
CSRT
0.943902804859757
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号