SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01117
Pre Gene Modal
BGIBMGA001718
Annotation
PREDICTED:_regulator_of_G-protein_signaling_3-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.818
 

Sequence

CDS
ATGCAAAGTGAGGCCCAGCTCAAGAAGTGCTGGGATAATTTAAAAACACGGAGGAAGCACTTTTTGGCTAATGAAAAGCGTCAGAGAATGAAGACTGGTGGCGGACAGTGTATTCCAAATGAGCCACAGCCTGGTAGCAGCAATGAGACCCTTATTTTTGCTGAGGTTCTACTGGATCAGACTGATGTGGAACTCAGGGGTGTCATTGACAGTGATACCATTTACAGTTCTGAAGGAAATGTTGCAGGCACCACGCCTATGCATTACAGTGTATCATGTCGTGACACCCCACAACGTCGTGATACTCCACCACGTCGTGACACTCCACCACGTCGTGACACTCCACCAAGTCGTGACACTCCACCAAGTCGTGACACTCCACCACGTCGTGACACTCCACCTAGTCGTGACACTCCACCAAGTCGTGACACTCCACCACGTCGTGACACTCCACCACGTCGTGACACTCCACCGCGTCGTTCTGGGTCCCGGCAGACTGACTGTGGTGCAGCCTACTTAGGAGGAGGGAATGTGCGCACCAGGGTAATTCAGGAGGAATTTAATTTTAGAAAAGAATCTTATGAAAAGAAAGAGAGAAGAGAAGACGAACTCTTTCAATTCCAAAAAAAGGAAAGAGAGTGGATGATGAAGGCAGCCGAAGAAGTATATCTAAAAGCGAAGGCTGAGAGGGAAGCTGCAGAGGATATTAAAAAATATAATCAGGCTAAAAGAGATTGTAGTGAAAAATAA
Protein
MQSEAQLKKCWDNLKTRRKHFLANEKRQRMKTGGGQCIPNEPQPGSSNETLIFAEVLLDQTDVELRGVIDSDTIYSSEGNVAGTTPMHYSVSCRDTPQRRDTPPRRDTPPRRDTPPSRDTPPSRDTPPRRDTPPSRDTPPSRDTPPRRDTPPRRDTPPRRSGSRQTDCGAAYLGGGNVRTRVIQEEFNFRKESYEKKERREDELFQFQKKEREWMMKAAEEVYLKAKAEREAAEDIKKYNQAKRDCSEK

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
249
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.14561
outside
1  -  249
 
 

Population Genetic Test Statistics

Pi
52.880199
Theta
69.074213
Tajima's D
0.096153
CLR
0.000122
CSRT
0.4018799060047
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号