SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01025
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.675
 

Sequence

CDS
ATGCCGCCGCGAAAAATACGCCAACAGACGGATGACAATAGTGATTCTGGTGATGAAAAGGTGGACGCAGTGCCCTCGCCAGCACCAGTGCTCATGTCCGGGGATCAGCTGTCCTCGCTCCTGGCCGCCTTCTCAAAGTCGCAGGCCGAGGCGAACCGACAACTCGTCGAGTCCCTGTGGGCATCGCATGGTTTGGGAAGTGGATCGAAGTTCACCACCCCGATAGTGTCACCGTCCCCGACGCCAACAAGTAACATGGCTAAATGCACCGCGCGTTTTGATGGCGTCGCTCGCGATCCGGAGGCCGTTGAAGCGTTTATCGACTCTGTGGAGGTGTACAAGGAGTGTGCGTGCGTCTCCGACGATATCGCATTGCGTGGACTACCAATGCTCATGGAAGGCGAAGCAGCCATATGGTGGAGAGGGGTCCGGAACGAAGTGTCCTCGTGGCCCGACGCTCTCAAAATGTTACGAGCTATGTATGGTGTGCCACGCCCTGCACATAAAGTTTTTCGTGACGTGTTTTCGTCTGAGCAAGGTGATGAGCTTGCTGACAGTTTCATAGTGAGGATACGTGCTATGCTGTCCAGATTGCCGTACCAGCTACCAGAGGAAGCCAGGTTAGACATAATCTATGGTCTACTTCATAAACGGATAAGGAAAAGACTACCGAGAGATGGTGTGAGCGACATAGAAACACTCATAGAGAAGTCGCGCATGGTGGAGGAGTCACTTGTGGAGTGCACGGCTGCCCCCAACATTCCGCCGCAGCCACACAAGTCGTTACCTACGGTGTTCGGCGAACGCAGCTCCGCGCCTGACGTGACAAGTGTGAGATCGCCGAGACCTGCCGGCGCTGCCGCTGCGCTAGTGCGCTCCTCCGTTGCTGTTGCACCGTCGTCGCTACCTCAACCGTCCCCATCCCCGCGTAGTGTGAAAAGCGAAACATTGCCCCGGGACATTCACCCTTTGTCATGTGAAAATTCACGTGACCCCATAAGTTGCGCTTCTATAAATTTGTTGCGCGAGGATGAAGGTAAATTCTTATCGGAGTCGGAAAAGGGGCGTCTGGTGGATTTACTAGGTGAATATACTGATGTTTTCGAGGAAGTCGATGAAAAGTTAGACCAACAAACTAAACTTATAACAACTACAGTAACACAAAATGTCATGGCAGCACTAGACGAAAAGTTTAAAGCGATCACCGAAGAAAATACCCAACTCAAAAATAAAATCAGTGAGCTAGAGTTAAAATTGAAATTCGCTGATAAGGATAAGCGCAAAAATAACCTTGTCTTTTTTGGCATCGAGGAAGGAAAAGCAACAACAGAAACGGAGCTAGTAGACTATATAAAAGACATTATACTGGAAATGGGAGTACATTTTGAAACCTTCGAAATTAATAATACTTACAGGATCGGTAAAAAAGAGCTCGATAAAAATCGCCCTGTTGTAGTCTCACTCACAACTACATGGAAAAAACACATGATTCTGCGAAATAGACGTAATCTACAAGAAGGTATAAATATCAAAGAGGACTACCCTAAAGAAATAATAGAAAAACGTAAACAACTACAGCGGCAAGTTGAAGAGGAAAAGAACAAAGGGAATATAGCGTTCATCAAATACGACAAACTGATAATAAAGAAAACACATGAAAGCAACAGAGAAAAGAGGAAAAGAGAGACTTCAAGATCACCGAAAACACCATCACAAAAGAAAGTCAATGCAAGTAATACCCAAAGTACATCGACCACCCTGAACAACGCCTCTTCTAAAACCGCGACAAAGGAAACAATGCGCCCAAATATACTGAACTATATAGAGCGCGGGAGATCCGCTTCATTATCAAATCCCTCAAAAAACTAA
Protein
MPPRKIRQQTDDNSDSGDEKVDAVPSPAPVLMSGDQLSSLLAAFSKSQAEANRQLVESLWASHGLGSGSKFTTPIVSPSPTPTSNMAKCTARFDGVARDPEAVEAFIDSVEVYKECACVSDDIALRGLPMLMEGEAAIWWRGVRNEVSSWPDALKMLRAMYGVPRPAHKVFRDVFSSEQGDELADSFIVRIRAMLSRLPYQLPEEARLDIIYGLLHKRIRKRLPRDGVSDIETLIEKSRMVEESLVECTAAPNIPPQPHKSLPTVFGERSSAPDVTSVRSPRPAGAAAALVRSSVAVAPSSLPQPSPSPRSVKSETLPRDIHPLSCENSRDPISCASINLLREDEGKFLSESEKGRLVDLLGEYTDVFEEVDEKLDQQTKLITTTVTQNVMAALDEKFKAITEENTQLKNKISELELKLKFADKDKRKNNLVFFGIEEGKATTETELVDYIKDIILEMGVHFETFEINNTYRIGKKELDKNRPVVVSLTTTWKKHMILRNRRNLQEGINIKEDYPKEIIEKRKQLQRQVEEEKNKGNIAFIKYDKLIIKKTHESNREKRKRETSRSPKTPSQKKVNASNTQSTSTTLNNASSKTATKETMRPNILNYIERGRSASLSNPSKN

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
622
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00209
Exp number, first 60 AAs:
0.00046
Total prob of N-in:
0.00205
outside
1  -  622
 
 

Population Genetic Test Statistics

Pi
282.188448
Theta
183.018879
Tajima's D
2.491227
CLR
13.996397
CSRT
0.943302834858257
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号