SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01023
Annotation
S08405_hypothetical_protein_2_-_silkworm_transposon_mag
Location in the cell
Nuclear   Reliability : 2.789
 

Sequence

CDS
ATGATCGTAGTTCTTTGGCATTACACGGTACTGGGGCCTTGGTTATGGCGTCAATTTAGGATTTGGTTGGGTGGATGCCATGTTCATATATTATGTGACTTGGGTATTCAATCTGATTCTGAGGTGATTTTAACACATGTGGGAGCTACAAATGAGGGCTATGAAAGGGTGCATGGAGGATGGGGGTATGGCAGTCGTAATGATGATGGAGACCAGCTGCTCCAAGCTGCGACCACCTTTAACCTGGCAGTGGAGAATACGTGGTTCCAGAAACGGCCTGAACACCTTATCACCTATAAGAGTGGTAACCACGCGACACAGATCGACTATTTTCTGATTAAGAGAAGTAAGTTGGTATGTGTCAAAAACTGCAAAGTACTGCCGGGTGAAGCATTGGTGACGCAGCATAGACTATTACTAATGGACATTACGATCAGTTACAAGTACCTAAGGAGGAGAAACCGTCTCTCACCAAAAATTAGATGGCGTATGCTAGAGTCAGATGAGTATGCTGGTCGATTTAGGGAAATAATGATAGAAAACATATTTGAAATGAAGGATATGAAAGAGAAATCTGCGAATGATTGTTGGGATGAAATGGCAAATAGTCTCAGGAAGACAGCTAAGGCTGTGCTCGGCGAATCAAAAGGGAAAGGTATAATTGACAAGGATACATGGTGGTGGAATGAGAATGTACAGAGAGAGTTGAAAGAAAAGAAGAATACATTCAAAAAGTGGCAACTAGAAAGAGGAAATGAAAGTGAGAAGCAAGCTAGGAAGAATGAGTATAGAGAATGTAAGAAAAAGGCCACTAAAGCGGTTGCTATAGCCAGATTAGAAATGTACTTTTTGGTGAATAAAGTGACTGACGATTTAAAATTACCCACATTAATTTCCGTTATGGGTGAGGAAGCGTACGATTTATTATCGACATTAGCCAGCCCTTCGAAGCCGTCACAGTTAACTTATGCTAATGCCGTGGCGATGTTGGCAGCTCACCTGCAACCGAAGCCCTCAATCTTGGCGGAAAGATACAAGTTTCGACAACGTCGGCAGCTGAATGAGTCAATAGCTGACTACGTCACAGAATTAAAAAAATTATCAAAAAATTGTGAGTTCGGCTCGTCGCTGGATGAAAATCTGCGTGATCAAATGGTTTGTGGATTAAAGAGCGAAATCATACGGCAAAGGTTATTTGCCGAGGAGAAATTAGAATATAAGCGTGCAGTTACGTTAGCTTTGTCTTTAGAAGCTGCGGAGAGGGATGCGATTGCAGTGGAACGTACGCCAATTGAGGAGGTTAACAAAATTAACTTCAATGAATGTTCAAGATGTGGAGACAGGAGACACCAAGCAAAGGATTGCATATACAAAGACTACGTGTGCAGTTCATGTCATGAAACCGGCCATCTACGAAGAATGTGCCCCAAAAAAGGGCTTAAGAACCAGGCGGAGGCAGCCGGGGGTTCACCATGCACCGGGCGCCGGGGGAACCGGGGTGCAGGCGGCAACAGGCGATCGTGGCGCGGGCAGCGCGGTGCGGGACGAGGAGGCCGAGAGCGGGCTCCTTTGCACTTATTATACGATCAAAACAACGATGACACATACAACAACTTCAATAATGAACAGGACGGGTGTGGAGAAGAAAATGAGCCTATGTACCAAATGACATTGAGTAATTATAAACCGGTGTGTATTAAAGTTAAAGTCCAAAATTGCTTGCTCAAGATGGAGGTCGATACTGGATCGGCGTTATCTTGTATTAGCAAGAATGTTTATGATAAATATTTTTCTAAGGAGAAGTTACAGGCATGCTTATTAAATTTAAAATTTTACGATGGCTCAATCATTCGGCCTTTAGGGTTTATAAACACTATAGTGAAGTACCAAGGTGTTTCAAAAATGTTAGACTTGTATGTCATACACAAAGGAACGACTAATCTATTGGGCCGACAATGGTTAGCTGAATTGAATATTCCTATAAAAATATCAAAACCTACGAGTTTTAAAATACAACACAGTAACTTTGTAACCGAACACGCACGAGACTATAATAAATTAATTAATGAAATTGTTTCTAGACATAAATCCTTGTTCGACGGCACATTGGGTAAATATACGGGGGGCACAGCAGAGTTAATCGTGCGGCCGGATGCGGTGCCTATCTACTGCCGCGCGCGACCGCTGCCGTATGCGCTGCGCGAGCGCGTCGATGCCGAGCTCGACGCGATGCTGGCCGCCGGCGTCATCAAACCGGTGGACCACTCCGACTGGGCCACGCCACTTGTCGTAGTACGCAAAGCGGACGGCGGTCTGAGAATATGTGCGGACTATAAGGTAACCCTTAACAAAGTATTAGCAATCGACAGATTTCCGGTTCCAAAAATGGAGGACTTATTCAGTAATCTCAGCGGAAATAAATTTTTTACTAAGCTTGATTTATCTCAAGCTTATAATCAAATAGTCTTATCAGAACATTCTAGCGAGTACACGGTTATCAATACACATAGAGGATTATTTAAATATTCCCGCCTCGTCTACGGGTTAGCTTCGAGCCCAGGCATTTTTCAAAAACTAATGGTAAATATGTTTAAAAATGTCCCAAATGTAGTAGTTTTCTATGATGACATATTGATTAGAAATCAGGACCTAGACAGTCATTTAAAGTCTATAAAAGAAGTATTAGATATATTAGAAAGGTATGGCTTAAAAATTAAAAGGAGTAAGTGCGAGTTCATGGTAACAGAAGTGAGGTATTTAGGGTTCATAATAGATCAAAATGGGGTTCGTGTAGACCCAGAGAAAGTCAAATCAATAGCAACAATGCCACACCCAAATAACGTGACAGAATTAAAATCTTTCATCGGTATGGTAAACTTCTATTCGAAGTTCATACAAGATTTGAGTGCACATTTATCACCTTTATATGCCCTTTTAAAAAAAGGTAAGCACTGGATGTGGGGAAATGAACAGAATGCTGCTTTCCTGAATGTTAAAAAGTTTTTGTGTAGTACAAAAGCACTCGCACATTTTGATATGTCTTTGGAGTCGGTGTTGACTGTGGATGCGAGCGCGCGTGGTCTGGGTGCCGTGTTGGCGCAGCGCGGGCCAGGATCTCCCTATCATTCCGCCTCTAATGGGGCCGCTGAAAATGCAGTTAAAATTTGTAAACGTGCGATTAAAAAGGCATTAAAACAGAATTTAAACGTAGATACAGCTCTGTGTAGATTTTTATTAGCCTACAGAAATACAGAACATGCAACTACCGGCGATAGTCCAGCCAATATATTACAGGGTCGAAGTCTCCGTATGAGATTAGATAATTTAAAACCAGAAAGGCAATCTCGAGTTATCGCGCAACAAGAGCGGAGCGAGCAAAACGCAGGGGGTGTGCAGCGACAACTCGAGCCGGGCACTAAGGTGTGGTATCGGGATTATCGAGGTCTGGATAAATGGGTACCTGGGACGATCCTCAAGCAATTAGGTAGTCGTGATTACTGTGTACGATCTAGTTTTGGAACCGAGAATCATAGGCACGTCGATCAGCTAAAATTAAGGGTTACAAAAAATATAGATAAAGTTGATACCTTTGCGTCGATTCGTAAAAATATAAGTCCCGAACTGATCGCGCAAAATTTAGACTTAAGAACACAATCACGTAAGTCGCTATCATTTCCCATGACAAGTGGCGAGGAACCAGTGGCGGTGGTCAACGATTCGGGGAAGAGTAGTTCACCACCAAAAAATAGCACACCGGCACAGGATGCTGTATCGCCTATTCGTGGCAGCCCTATGAGACCCACAGTGCCGATAGACAAGGCAGCATGTAGTACTGGTGGTAAGAGTATCAATGAAAATGTGACACCCAAACGTGAACGTCCTGTAAGAATACGCAAGCCACCAGTTAGATATGGATTCGAGGAAATAGATTAA
Protein
MIVVLWHYTVLGPWLWRQFRIWLGGCHVHILCDLGIQSDSEVILTHVGATNEGYERVHGGWGYGSRNDDGDQLLQAATTFNLAVENTWFQKRPEHLITYKSGNHATQIDYFLIKRSKLVCVKNCKVLPGEALVTQHRLLLMDITISYKYLRRRNRLSPKIRWRMLESDEYAGRFREIMIENIFEMKDMKEKSANDCWDEMANSLRKTAKAVLGESKGKGIIDKDTWWWNENVQRELKEKKNTFKKWQLERGNESEKQARKNEYRECKKKATKAVAIARLEMYFLVNKVTDDLKLPTLISVMGEEAYDLLSTLASPSKPSQLTYANAVAMLAAHLQPKPSILAERYKFRQRRQLNESIADYVTELKKLSKNCEFGSSLDENLRDQMVCGLKSEIIRQRLFAEEKLEYKRAVTLALSLEAAERDAIAVERTPIEEVNKINFNECSRCGDRRHQAKDCIYKDYVCSSCHETGHLRRMCPKKGLKNQAEAAGGSPCTGRRGNRGAGGNRRSWRGQRGAGRGGRERAPLHLLYDQNNDDTYNNFNNEQDGCGEENEPMYQMTLSNYKPVCIKVKVQNCLLKMEVDTGSALSCISKNVYDKYFSKEKLQACLLNLKFYDGSIIRPLGFINTIVKYQGVSKMLDLYVIHKGTTNLLGRQWLAELNIPIKISKPTSFKIQHSNFVTEHARDYNKLINEIVSRHKSLFDGTLGKYTGGTAELIVRPDAVPIYCRARPLPYALRERVDAELDAMLAAGVIKPVDHSDWATPLVVVRKADGGLRICADYKVTLNKVLAIDRFPVPKMEDLFSNLSGNKFFTKLDLSQAYNQIVLSEHSSEYTVINTHRGLFKYSRLVYGLASSPGIFQKLMVNMFKNVPNVVVFYDDILIRNQDLDSHLKSIKEVLDILERYGLKIKRSKCEFMVTEVRYLGFIIDQNGVRVDPEKVKSIATMPHPNNVTELKSFIGMVNFYSKFIQDLSAHLSPLYALLKKGKHWMWGNEQNAAFLNVKKFLCSTKALAHFDMSLESVLTVDASARGLGAVLAQRGPGSPYHSASNGAAENAVKICKRAIKKALKQNLNVDTALCRFLLAYRNTEHATTGDSPANILQGRSLRMRLDNLKPERQSRVIAQQERSEQNAGGVQRQLEPGTKVWYRDYRGLDKWVPGTILKQLGSRDYCVRSSFGTENHRHVDQLKLRVTKNIDKVDTFASIRKNISPELIAQNLDLRTQSRKSLSFPMTSGEEPVAVVNDSGKSSSPPKNSTPAQDAVSPIRGSPMRPTVPIDKAACSTGGKSINENVTPKRERPVRIRKPPVRYGFEEID

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=4.17374e-42,     Score=436

Ontologies

Topology

Length:
1310
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10242
Exp number, first 60 AAs:
0.10167
Total prob of N-in:
0.00569
outside
1  -  1310
 
 

Population Genetic Test Statistics

Pi
132.9726
Theta
201.173876
Tajima's D
0
CLR
1.961759
CSRT
0.369881505924704
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号