SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00992
Pre Gene Modal
BGIBMGA001375
Annotation
PREDICTED:_atf2_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.285
 

Sequence

CDS
ATGGCGAAAGCAACATCTGGAAAAAAAGCAATAATTTCCGATGACGATGTCGATCAGTTGTTGCAACCACATCAGACAACCAAGGAGATGGCATTTATGCGTTTACAATCGTTGTACGAGATGTCACGAGTAGTTAGAAGTAATACTGATATGCAGCCACAATTTCGCGCCCGTTTTAGAGATATTGTCGCTTTGAGAACTGCATATGAAAGTGCTATGAGTGAAATGATTTGTGTCCAAAAACGCTATAATGCGTCGTATGTACCGTCATACGACCAAATCAAAGCATTTGATGAGATGTATTACTCTGTTTGTGATATCGCGGATAGCCTAAATTTATCAGGTAGTGATAATACTAGATGTGATTTCGGTTCCGGTAAAACTGTAAAACCTCGATTACCGAAATTAGAAATTTTCCACTTTGACGGAAAGTTAGAAAATTGGCCCACGTTTAGAGACACCTTTACTAGTTTAGTACATTCTAATACTGATATAGTTGATATTGAAAAATTTTATTACTTATTGTCGGCTGTGAGTGGTCCAGCACTCACTATCGTAAAATCAATGCCGATAACAGCAACAAATTATTCGATTGTATGGAATTCTTTAGTTACACGTTTTGAAAACAAGAGGGCGCTAGCGACTACATATTTAGATAAAGTCTTTAGTTTCAAACCATTACAATATGAGTCAGTAGACGGCCTAAATGCCTTTTTACAAGGGTGTCAAGATAGGGTCAAAGCATTAAAATCATTAGACATACCAGATTTATCAAGTTTTGTTTTGTTTTATGTAGCTTTGCGTAATTTGGATTCAACTACTAGGCGCGCATTCGAAAACAAAAGTGTACCGGGTGATCTTCCGACATTTGAGGGTCTTATCGCTTTCGTGGAAAACCAGGTCCGTATCCTGGAGATGTCGGAAAGTAAATCGGTCTCAAACCAAAGCATAGACAATGCAAAACCTATATACGCAAAGGGTTACCAGAATTCCAGTCGTTTTGATAAAAAGCTTAATATTTCAAATGCCAGGGTGGGTGCGCCTAGAACATCTTTGGCCTCAGCCGCAACTGCGGCTACTAAGAATCTTCAGAACAAACAAAACTCGAATGAAACTTTAAATAAAATTAAAAAATGTTATTATTGCGGGAAGCCTCATTCAATATATCGGTGCTTCGAATATAGTGATCTCACTCCTGAACAACGGCTTCAAAAAATAAAACAGTTGAAATTATGTGAAAATTGTTTGCGTGATGATCATAATATATTAAAGAGTTGTCCATCTAGGGTACGTTGTACAGTTTGCAAAAATATGCACCATCACACACTTCACATCGATGCTGGCGCTGGTGCCAATTCAGGAAATAATGCCAGCTCGGTGGCTCTTACCGTTTCTACAACTTCGAAAGTCTTGCTCGGAACCGCAATTATACACGTCGCAAATTGTTGGGGCATCTATCAACCCGTACGTGCTATAATTGACAGTGGTGCCATGACGGGCTACATAACTCAAGACTGTGCATTAAGGTTAGGACTAGGGCGGAGAAAGTGTGATTTCGATTCTATTGGTCTAGGTGCCAAGCCTATTGCAGATCTGGGGCTAACTACCTGTACTGTAAAACCGCGTCAGTGCGATAGCCCCATATTAACTACTGATGTAGTCATAGTTGCAAAAATAGCCGGAAATCTACCGACTATGTCTATATCAGATGATGTGATCCGTAAATTTCAAAATCTTCCACTTGCTGATCCAACTTTTGGTACACCGGGTCCCATCGACATGTTACTGGCCGGAGATCTGTTTCCTCAAATTTATGATGGAGAAAAAATCATGCCACAAGATAAGAATATGCCGGTGGCACTGCATTCCATTTTCGGTTACGTTATTGCAGGTCAAGTCTTTACTTCGGCTCATAGAACTTTAAACGCGGAAAATTGTCATATCAAAACTAATAATACGAAATCATTTGTGGCTCTTTCTGTGAACTTGGAGCAAGAAACGCAGTCTGTCTCTGAGATGGAAAGTATTCTTAACAAGGAACCACAACATCCAGATAAAAAAATAATATCAGTAGGGACATTGTCTGATCGCGATCATAACCGTGATAAGAAAAGTAGATGTTTCGTAAACTACCCTTTGGAACCTTTTTATAAACTTTATGTTTCATATGGAGCAGAAGAACGTAAATACATTGATATAGGAAATAATTTGGAACGCGATCCGAAATTTATTCGTGAGTACGAAAGTCTTGGTGGACACAAGAGCCACGTAGATAATGCCAATTTTGTGTCGGCTACGAAACATTTGGCAGATGTTACGCGTTTTTTCGAATCACACTTAGAAAGCTTATCAGGAGAACTTGTAGCACGTAATATTCGTTGGAGCCATTACCCTCCTAGTGGTGGTCGTTTCGGTGGCTTCTATGAGTCTGCAATAAAATCTGCTAAATTATATTTGAAACGGATTGTAGGAGACAAATCATTTCCATTCAAAGAGCTCCGAACGCCTTTTGCTCGGTTTGAAGCAGTTCTCAATTGTAGACCGCTATGTCCACTGTTTGATGATCCAGAGGAGTTCCAAGTGCTGACGCCGGCACATGTTGTGATCGGGCGGGAATTGTTCGCTGTACCGGTATTCGATATCAAACCAGAAAAACCATTTGCTTGTACGATGCCAGACTGCGGCATGACCTTTACTAATGAGGATCATCTGCAATTACATACTAAAAAACACGATATGATGTTACAATTAGGTTTGGAGCAAAAAGCAGCTTTTGTTGCTGATCAAACCCCAACTCCTACAAGATTTATCAGAAATTGTGAAGAAGTAGGTCTCTTTCAAGATTTACAAAATGACAACCCCTTTGATGAAGGCTTCAAAAGAGCCATGGAAACTAAACAACACATCTTATCTCTCGAGAGTATTGCAACAATATCAAACACAGATGATCTACATACACCACAGATGGTGTTCCCACTGGAACACACTGATTCGACATTGTTCAGTACCACAAATAACCAGAGAAATATCACTATTAGCAGATCATCAAGTGACGAATCTGGAGCTATCAAAGAATTTGAAACGACGACAATATCTAAATTAACAAATGAAGTAACAACAATAAGTCGTATAGTCGAGAAACACGATGATAACCGAGTAGATGATTCCAAACTCAAAGACGAGGTCATCAAGGACTCAATTTCATACTCAAATAATATAATTAAAATACACAGTGAAATCCGAAGAGATGATATGAACAAAAATCCGATACAAACATTTGAAGATACCACAAAGAACAATAAAATAACTGATGTCCCGCCTATAATGAGTCAAACCTCTATAGATTATGTTGTCGAAACATTAACTAATGACTTATGCAATGACACAGCTAACAAACATGATGAAAGTGATAATATAGAAGTATTAATAAGATTGCCAAACGGTAGACAAGTGAGAATGAAGTCAGTGGAGGATGAACCAAAAGTAAACGCTAAAGAAAAACTCAAAAGAGTTTTGTCGGAGAAATCTAAAACTAAAAGTCCCACTATCTCGAATTTAGTACCAATAAGTGGTGGAACACTAATTCCAGTCACGATAGTAGCAGCTCAACCACAAAAGATACCCATACCACCATTTAGAGTTGCTAGGAATTACGATAAGAAAGCAGTGAAGCGAAAAAATTTAGACACCGGGAATCAGTGTCACAGTGTCTCGAGTGAGAAGCAGAGTGATTTGGACAGTCGCAGTGCAGCATCGAGGAGATATAGAGCGAGATTAAAAGAGTCCTGGATAAAACAGTGCGAAGAAAATAGACAGCTGAGAGCATCAAATGACAGACTATTGTCGGAATTGACAAAATTAAAATTATTGCTAACGGAACACCTGAAGAGATGCCCTAATGCTGATGACATAAGTACGATACAAGAAAAATTATAA
Protein
MAKATSGKKAIISDDDVDQLLQPHQTTKEMAFMRLQSLYEMSRVVRSNTDMQPQFRARFRDIVALRTAYESAMSEMICVQKRYNASYVPSYDQIKAFDEMYYSVCDIADSLNLSGSDNTRCDFGSGKTVKPRLPKLEIFHFDGKLENWPTFRDTFTSLVHSNTDIVDIEKFYYLLSAVSGPALTIVKSMPITATNYSIVWNSLVTRFENKRALATTYLDKVFSFKPLQYESVDGLNAFLQGCQDRVKALKSLDIPDLSSFVLFYVALRNLDSTTRRAFENKSVPGDLPTFEGLIAFVENQVRILEMSESKSVSNQSIDNAKPIYAKGYQNSSRFDKKLNISNARVGAPRTSLASAATAATKNLQNKQNSNETLNKIKKCYYCGKPHSIYRCFEYSDLTPEQRLQKIKQLKLCENCLRDDHNILKSCPSRVRCTVCKNMHHHTLHIDAGAGANSGNNASSVALTVSTTSKVLLGTAIIHVANCWGIYQPVRAIIDSGAMTGYITQDCALRLGLGRRKCDFDSIGLGAKPIADLGLTTCTVKPRQCDSPILTTDVVIVAKIAGNLPTMSISDDVIRKFQNLPLADPTFGTPGPIDMLLAGDLFPQIYDGEKIMPQDKNMPVALHSIFGYVIAGQVFTSAHRTLNAENCHIKTNNTKSFVALSVNLEQETQSVSEMESILNKEPQHPDKKIISVGTLSDRDHNRDKKSRCFVNYPLEPFYKLYVSYGAEERKYIDIGNNLERDPKFIREYESLGGHKSHVDNANFVSATKHLADVTRFFESHLESLSGELVARNIRWSHYPPSGGRFGGFYESAIKSAKLYLKRIVGDKSFPFKELRTPFARFEAVLNCRPLCPLFDDPEEFQVLTPAHVVIGRELFAVPVFDIKPEKPFACTMPDCGMTFTNEDHLQLHTKKHDMMLQLGLEQKAAFVADQTPTPTRFIRNCEEVGLFQDLQNDNPFDEGFKRAMETKQHILSLESIATISNTDDLHTPQMVFPLEHTDSTLFSTTNNQRNITISRSSSDESGAIKEFETTTISKLTNEVTTISRIVEKHDDNRVDDSKLKDEVIKDSISYSNNIIKIHSEIRRDDMNKNPIQTFEDTTKNNKITDVPPIMSQTSIDYVVETLTNDLCNDTANKHDESDNIEVLIRLPNGRQVRMKSVEDEPKVNAKEKLKRVLSEKSKTKSPTISNLVPISGGTLIPVTIVAAQPQKIPIPPFRVARNYDKKAVKRKNLDTGNQCHSVSSEKQSDLDSRSAASRRYRARLKESWIKQCEENRQLRASNDRLLSELTKLKLLLTEHLKRCPNADDISTIQEKL

Summary

Uniprot
ProteinModelPortal
PDB
1BHI     E-value=1.51257e-06,     Score=129

Ontologies

Topology

Length:
1311
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.706669999999997
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03016
outside
1  -  1311
 
 

Population Genetic Test Statistics

Pi
255.347204
Theta
195.525365
Tajima's D
1.262606
CLR
0.533698
CSRT
0.729713514324284
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号