SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00988  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001370
Annotation
Talin-1_[Papilio_xuthus]
Location in the cell
Nuclear   Reliability : 2.152
 

Sequence

CDS
ATGGCGACCCTATCGTTGAAGATCTCCATTGACGGAGGCAAGGTCGTGAAGACAATACAGTTCGAACCCTCCACCACAGTGTACGACGCGTGCCGCATCATCAGGGAAAAGATCTTGGAGGCCACAGCGGGAGACCCAAAAGAGTATGGCCTCTTCTTGGCTTCGGAGGAAGACAACAAGAAGGGGATATGGCTGGAAGCGTCCCGAAGTCTTGACTATTACATGCTAAGGAACGGAGACCTTCTGGAGTACAACAAAAAGACCAGGAATCTCAGAGTCAGGATGCTTGATGGTACTGTGAAAACCCTGCTGGTGGACGACAGTCAGATCGTCGCGAACCTCATGGTAGTGATTTGCACCAAGATCGGGATCACCAACTATGACGAATACGGCCTGGTTCGGGAAGAGCAAAAGGAGGAACCGGATCCCTGCGAGAAGCCAAACTACGGGACTCTGACCCTGAAGCGTAAGCACCAGGAGAAGGAACGAGACGCCAAGATGGAACAGCTCAGGAAGAAACTCAGAACTGATGACGAAGTGAACTGGGTGGAGGGGTCGCTGACCCTTCGTGAGCAGGGCGTGGAGGCGGGCGAGACCTTACTGCTGCGCCGCAAGCTGTTCTACTCGGACAGGAACGTGGACTCGCGCGACCCCGTGCAGCTCACCCTGCTGTACGTGCAGGCCAGGGACGCCATCCTGGCCGGCGCGCACCCCACCACGCAGGAGAAAGCTTGCGAGTTTGCCGGGATACAGTGCCAGATACAGTTCGGGGACCACCGGGAGGACAAGCACACGCCAGGATTCCTCGATTTAAAAGAGTTCCTGCCGGCCTCGTACGTGAAGGTGAAAGGCATCGAGAAGAAGGTGTTCAGGGAGCACAAGAAGCACGTCGGGCTCAGCGAGCTGGACGCCAAGGTGCTCTACACCAAGACGGCGCGGGACCTCAAGACCTACGGAGTCGCCTTCTTCCTCGTCAAGGAAAAAATGAAAGGCAAAAACAAACTGGTACCGCGTCTTCTGGGAGTCACGAAGGACTCCGTGCTCAGACTGGACGAGAAGACGAAGGAGATCCTGCAGACGTGGCCGCTCACCACCGTGAGGAGGTGGTGCGCCAGCCCCAACACTTTCACCCTCGACTTTGGCGATTACAGCGACCAGTACTACTCGGTGCAGACCACGGAGGCGGAGCAGATCCTGCAGGTCATCGCCGGCTACATCGACATCATCGTGCGGAAGCAGCGGGCCAAGGAGCACCTCGGCATCGAGGGAGACGAGGGCTCCGCCATGCTCGAGGACTCCGTGTCGCCCTCCAAAGCGAACATCATCCAGCACGACACGTTCAAGTCCGGTAAAGTGAACACCGAGTCCGTCGCCAAGCCGGCGGTGCACCGGCCCGGAGCTGAAGGTGCGAAGCCGTTCGCCGTGGGGCACGTGACGGGCGCGCAGCTGACCACGGTCTCCGGGCAGGTGGTGACGGGGCACGCGCCGCCCGCCGCGTCGCAGGTACAGCAGACCAAGGTGACCTCGATACTCACGGAACCTCAGCGGGCCCTGTTGACCACCATCACCAGCGGCAGGGAGATCATCAAGCAGACCGAAGAAGGACTCAGCAGGACAACCCTGCCCGAACTGGGAGGTGACGCATCCTCAGTGAAATGGAAGCAGTCGACCCTGGACACCAACAAGCAGGCCGTCAGCTCGCAGATCGCGGCCATGAACGCGGCCACGGCGCAGGTCGTCACCCTCACCGCCGGTCCAACCGAAGAGGTAGACCACACAGCAGTGGGTGCCGCCATCACGACCATCACCAGCAACCTGCCGGAAGTGACGCGCGGGGTCAGGATGATCGCAGCCCTCATGGACGACTCCGACAACGGAGACAGACTGTTGGACGCCACCAGGAAACTTTGCACCGCGTTCACCGACCTGCTGAAGGCGGCCGAGCCGGAAACGAAGGAGCCGCGCCAGAACCTGTTGAACGCAGCCTCCAGGGTCGGGGAGGCGTCCACGTCCGTGCTGTACACCATCGGGGAGGAGACCGAGGAGGACAAGCAGACGCAGGTAACCGAGCCGGATAAAAAGAAAAAATCCTTCCTCTACAGGAAACTCAATTACTGCTACGACAACTTCTACAACGTCTTCTTTAGTAAGGACAAGTTCGGAGATGATTTCGACGATGGTAGAGTAGACGACGGCGTGTATGAGGACGTCGACGTCACCAGGACCTGGGGCCTGGACGCCATCCAGGAGGAATCCGATAGTGACTACTACAGAAGCCTGGCCTACTGCGACGCCGTGCTACGCCCCGGAAGGCCGGCCAACTTCCACAACAACCGCACTGATGACGCGGACCTAGAGTCCATCATAGGGACGTGCGTCGATTATCTCGATAAGAAAATCGATAACAAAACCGAATTGAATAACAGCGACAGCGATTACGAACCGATAGGCTTCGCGCCCGGCCGCCCCCCGCGACCCCCGCCGACGGTCACGGACAAGATATACAACTTCAAAAATGATTTTTCTAATCACGACTACGCTAACGTAAACTACGACCCGCCGAAACACGACTACTCCAGCGTCAACCTCCACCGCCGGACCAAAAACGATATATTGAGGCAACGGTTCTTTCTATCGAACAATATCGATAAAAACGATATAAACGATCGATTCAATCGATACAAGGATAAGAAGATCGAATGTCACAGCATCAGGAACGACGTCACCAAATCCGGTCCCGACGTGAGCGTGGCCGGCGCTCTGAACCTCAAAATCCTAAACCCGGATAGATACAACCGGGTGCTGACGACGAAGGAGACGTTCTACGAGGAATCCGAAGCCAGCTTCACTAAGACGAGCCTATCGAAACTAAAGAACGATCGCTTCGAGAATTTTGTTAAGAAAAGCGAGAAGTACTACACTAGTAGTGACGGTAGCGACCGCAAAACAGAAATCTTAAATAATTCCGAGGGACAACTTAGACCCAAAACGGAGATACGCATCGTGTACAACCCGACGTTCCGCGTGCGGGGCGGACACGACCGCGGCGCCCGCCCGTGCTCGTCTCCCAGATTTCACCTCATGATCCTGTCATGGGTGATGTCTGGATTGATTAATATTATTATAGGGTTGATGGACATCCTTCTGTCTCTCGCCAAAGCCGTAGCCAACACGACGGCAGCTTTAGTGTTGAAAGCGAAGAACGTGGCGGCCCAGTGCCGGGACGACCAGCAGCTGCAGAACAACATCATAGCCGCGGCCACGCACTGCGCCCTGGCCACCAGCCAGCTCGTGGCCTGCGCCAAGGTGGTGGCGCCCACCCTGCACAGCGCGGCGTGTCGCGAGCAGCTGACGAGCGCGGCGCGGCAAGTGGCGCAGGCCGTGGACCGGCTGGTGGAGGCCTGCGCGCCCGCACCGGCCGCGGCGGCGCCCGCGCGCGACCAGCTCGCCGCCGCCGCGCACTGCGTCTCCGAGGAGCTGGAGAGGCTGCTGGCCCACTGTCAACTTGAGCGCGGGGGCGCGGCGGCGGCGGCGGGGCGCGCGGTGGAGGCGGTGCTGGGCGCGCACGAGCGGCTGCTGGCGGCCGCCGGGCCAGCCGACATGCTGCGCCACGCCAGGCAGCTGGGACACGCCACGGCGCTGCTCATCACCAACATCAAGACCGAGGCCGAGGAGTCACCGTCGGACTCCCAGCGCAAGCTCCTAGCCGCCGCCAAGCTGCTGGCCGACGCCACGGCCCGCATGGTGGAGGCGGCCCGCCAGTGCGCCTCCTCGCCACAGGATCGGGAGAAGCAAGAGGTGCTCCGCAAAGCGGCGGAGGAGCTGCGCTTCATCACGGCCGACTACGCGCAGGGACAGGACATCGTCGGCTCACAAGTGGCCAGGCTGCAGGAAAGCGCCCGGCAGGCGACGTCCAGCGCCACGCAGCTGATAACGTCGGCCCAGAACGCAACGCAGTACAACACCAACAGATACTCTCAGGAGACCCTTCTAGAAGAGTGCAAAGTGCTGAACGAGCACCTCCCCCGCATGGTGGAAGCCGTGAACGTGTCCAACGTGAAGCCGACGCAGGCAGCGGCCAGGCTCGACCTCATCTCTGCATCTGAAGCCTTCTTACAGCCAAGTGGCCACGTGATCTCAGCAGCCCGAGGCGCCCTGCCGACCGTAAGCGAGCCCTCCGCAGCCAAGCACCTGGCCGACAACACGCAGCTCTACACTTCAAGCTGCGCCGACCTCAGGTCCGCAGTGAGCAGAGCCAGGATATCCTGCAAGGGCTTGGAGCTGGACGCAGCGGCGGAGATCATCAAATCCCTGCAAGAGGAGCTTGATGAGCTGGAGGAGGCGGTCAGGGCTTTCGACCTGAAACCCTTACCCGGGCAGACGGCGGAGTGGGCCGCGGCCACCATGAACTCCGCGTCCCGCGCCGCCGCCAGCTCCACCGCGCGCCTCGTGTCCGGCGCCAGCGGCTCCCACGCCGCGCCCGACCTCGCGCACGCGCTGCGGGACTTCACGCACGGGCTGCGCGCCGCCGCCGCCGCCGCGCCGCCTCCCCGCGCGCACAGAGTGATATCATCAGGGCGGCAGGTCCTGTACTCGTCCCTGACCCTCGTGGAGACGGTCAAGAAGCAGATCAGCAGCTCGGAGCAGGTGGACAGCGCCGCGCTCGCCTCCATAGCCAAGGACATCACGCACGGTCTAGAGCAGACGATGGAAGCGGTTCCGTCTCACACAGAGCTGGACCTCGCCATGGAGAACATCAACGAGACCCTCAACATTCTGAACATGGGCGAGTTCCCGCCCACGGACAGCTCCTATGGGGAACTCCAAGTCCAGCTGAACTCGGCGGCAGCAGGCCTCAGCCAGGCCTCGTCGGCCGTGGTGCAGAGCGTGGACGACCCCCGGACCCTGGCGGACTCCAGCCACAGCTTCGGACAGGCCTTCAACAATCTGCTCGGAGTCGGCATGGAGATGGCTGGACAAACTGAGGACCGCGAGACTCAGTCGTTGATGGTGAACTCCATGAAGTCGGTGACCGTCAACTCCTCCAAGCTCCTCGGGACAGCGAAGTCCGTCAGCCAGGACTTATCCCGCCCGAACGCCAAGAACCAGCTGACGGCCGCCGCCCGCGCCGTCACCGACAGCATCAACAAGCTGGTGGACGCGTGCACGCAGGCGGCGCCGGGACACAAGGCGTGCGGCGCGGCGCGGCGCAGCGTGCAGGCCGCGCGCCCGCTGCTGGACGCGCCCGCGCAGCCGCTCTCCGACCTCTCCTACTTCGCGTGTCTGGACGCCGTGCTCGACCACAGCAAGCAGCTCAGTGAGTGA
Protein
MATLSLKISIDGGKVVKTIQFEPSTTVYDACRIIREKILEATAGDPKEYGLFLASEEDNKKGIWLEASRSLDYYMLRNGDLLEYNKKTRNLRVRMLDGTVKTLLVDDSQIVANLMVVICTKIGITNYDEYGLVREEQKEEPDPCEKPNYGTLTLKRKHQEKERDAKMEQLRKKLRTDDEVNWVEGSLTLREQGVEAGETLLLRRKLFYSDRNVDSRDPVQLTLLYVQARDAILAGAHPTTQEKACEFAGIQCQIQFGDHREDKHTPGFLDLKEFLPASYVKVKGIEKKVFREHKKHVGLSELDAKVLYTKTARDLKTYGVAFFLVKEKMKGKNKLVPRLLGVTKDSVLRLDEKTKEILQTWPLTTVRRWCASPNTFTLDFGDYSDQYYSVQTTEAEQILQVIAGYIDIIVRKQRAKEHLGIEGDEGSAMLEDSVSPSKANIIQHDTFKSGKVNTESVAKPAVHRPGAEGAKPFAVGHVTGAQLTTVSGQVVTGHAPPAASQVQQTKVTSILTEPQRALLTTITSGREIIKQTEEGLSRTTLPELGGDASSVKWKQSTLDTNKQAVSSQIAAMNAATAQVVTLTAGPTEEVDHTAVGAAITTITSNLPEVTRGVRMIAALMDDSDNGDRLLDATRKLCTAFTDLLKAAEPETKEPRQNLLNAASRVGEASTSVLYTIGEETEEDKQTQVTEPDKKKKSFLYRKLNYCYDNFYNVFFSKDKFGDDFDDGRVDDGVYEDVDVTRTWGLDAIQEESDSDYYRSLAYCDAVLRPGRPANFHNNRTDDADLESIIGTCVDYLDKKIDNKTELNNSDSDYEPIGFAPGRPPRPPPTVTDKIYNFKNDFSNHDYANVNYDPPKHDYSSVNLHRRTKNDILRQRFFLSNNIDKNDINDRFNRYKDKKIECHSIRNDVTKSGPDVSVAGALNLKILNPDRYNRVLTTKETFYEESEASFTKTSLSKLKNDRFENFVKKSEKYYTSSDGSDRKTEILNNSEGQLRPKTEIRIVYNPTFRVRGGHDRGARPCSSPRFHLMILSWVMSGLINIIIGLMDILLSLAKAVANTTAALVLKAKNVAAQCRDDQQLQNNIIAAATHCALATSQLVACAKVVAPTLHSAACREQLTSAARQVAQAVDRLVEACAPAPAAAAPARDQLAAAAHCVSEELERLLAHCQLERGGAAAAAGRAVEAVLGAHERLLAAAGPADMLRHARQLGHATALLITNIKTEAEESPSDSQRKLLAAAKLLADATARMVEAARQCASSPQDREKQEVLRKAAEELRFITADYAQGQDIVGSQVARLQESARQATSSATQLITSAQNATQYNTNRYSQETLLEECKVLNEHLPRMVEAVNVSNVKPTQAAARLDLISASEAFLQPSGHVISAARGALPTVSEPSAAKHLADNTQLYTSSCADLRSAVSRARISCKGLELDAAAEIIKSLQEELDELEEAVRAFDLKPLPGQTAEWAAATMNSASRAAASSTARLVSGASGSHAAPDLAHALRDFTHGLRAAAAAAPPPRAHRVISSGRQVLYSSLTLVETVKKQISSSEQVDSAALASIAKDITHGLEQTMEAVPSHTELDLAMENINETLNILNMGEFPPTDSSYGELQVQLNSAAAGLSQASSAVVQSVDDPRTLADSSHSFGQAFNNLLGVGMEMAGQTEDRETQSLMVNSMKSVTVNSSKLLGTAKSVSQDLSRPNAKNQLTAAARAVTDSINKLVDACTQAAPGHKACGAARRSVQAARPLLDAPAQPLSDLSYFACLDAVLDHSKQLSE

Summary

Pfam
PF09141   Talin_middle        + More
PF16511   FERM_f0
PF01608   I_LWEQ
PF09379   FERM_N
PF00373   FERM_M
PF08913   VBS
Interpro
IPR035964   I/LWEQ_dom_sf        + More
IPR000299   FERM_domain       
IPR015009   Vinculin-bd_dom       
IPR015224   Talin_cent       
IPR019748   FERM_central       
IPR036723   Alpha-catenin/vinculin-like_sf       
IPR030224   Sla2_fam       
IPR011993   PH-like_dom_sf       
IPR036476   Talin_cent_sf       
IPR018979   FERM_N       
IPR002558   ILWEQ_dom       
IPR037438   Talin1/2-RS       
IPR035963   FERM_2       
IPR019749   Band_41_domain       
IPR032425   FERM_f0       
IPR014352   FERM/acyl-CoA-bd_prot_sf       
SUPFAM
SSF109885   SSF109885        + More
SSF47220   SSF47220       
SSF47031   SSF47031       
SSF109880   SSF109880       
Gene 3D
ProteinModelPortal
PDB
3IVF     E-value=3.93008e-148,     Score=1352

Ontologies

Topology

Length:
1774
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.55189000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00033
outside
1  -  1774
 
 

Population Genetic Test Statistics

Pi
273.45636
Theta
180.562406
Tajima's D
1.983299
CLR
0.498672
CSRT
0.880605969701515
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
31250652 GNNQGSVLSFVSIR 100.00 5e-07
28556443 GALPTVSEPSAAK 100.00 5e-07
26280517 QATKDAGTISGINVMR 95.65 5e-07
28467696 QATIGDVNIAQPSGIVESAK 95.65 5e-07
28467696 ACAITVADTARPGDPQPPIAPTTGEASIANIDSIR 100.00 5e-07
26822097 IVEACAPAPAAAAPAR 100.00 8e-06
26280517 FIPSFITVEEMR 100.00 8e-06
28467696 FISTITPQEMPMATR 100.00 8e-06
26822097 AVANTTAAIVIK 100.00 1e-04
26280517 MNPDMDDDEKGK 100.00 1e-04
28467696 MVDVNISK 100.00 1e-04
26822097 EAVIPAIR 100.00 0.001
26280517 TINVPCMDAEAIKK 100.00 0.001
28467696 TIPYWNNVIVPQIK 100.00 0.001
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号