SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00972
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
PlasmaMembrane   Reliability : 1.118
 

Sequence

CDS
ATGGCAGAGTGGTTCATCGACATCGCGATTGTTGCGGAGCCATACTTCGTACCTCCCGACCGGGAAGATTCCTGGGCCGGAGATGTTGATGGCTCCGTGGCGATCGTGATGCGACAGTCGGCGGCGTTACCCCCCCTTGGAATGGTGGCCAGGGGTTCCGGGTACGTCGTAGTTAGGGTCGACGAAACCGTCGTGATCGGGGTGTACTTCTCTCCGAACAGGAGTCTCGCTGAGTTCGAGCGGTTGCTGGGTGGGCTCGAGGCGTTGGTTCATCGCTTCGAGTCTCGCCCGGTGATACTGGCGGGGGACCTCAACGCTAAATGTACGGCGTGGGGTTCTCCCCGCACGGACTCGCGCGACGAGTTCCTGTCGGAATGGGCTTTCGCGACCGGCCTCTGTCTTCTGAACAAAGGTTCGGTCGCGACCTGCGTGCGGTGGAACGGGGAATCACACGTGGACGTGTCGTTCGCGTCTCCGTCCGCCGCACGCCGTGTCCGTGGCTGGCGTGTTCTCGAGGGGGCGGAGACGCTCTCGGACCATCGGTTCGTCCGATTTGAGCTCTCCGTTTCCACCTTGTTGAACGCGCCGGCCGAAGACGCCCGCGGTGAGGAGGAGCTCCCGCGTAGTGCTCCCCGATCATTCCCGCGATGGGCACTGAAGCGCCTGAATAAGGTGCTTGCGGTGGAGGCGGCCACAGTGGCCGCATGGGCGCCGATGCCCGCGCGTCTAGTGTACGTGGAGGTGGAGGCCGAATGGTTCCGGGGCACGATGCGTCGCGTCTGCGATGCTGCGATGCCCCGGGTCAACGGTCGCGCTCCGCGTGGCGGTGCGTATTGGTGGACGCCCGAGATCGCGCTCCTCCGAGAGGAATGCGTGCGCCGAAGCGCCCGCCACCGCCGTCGCCGCCTTCGCGATGCGGACTTCGCGGAGGTGGCGACCCGCCTGCATGCCGACTGCTGTCAGAATCAGGAGGCACTGCGGCGGGCCATCGGCGAGGCCAAGTCTCAGAGTATGAAGACGCTCCTGGAGACGCTTGACCAAGATCCTGGGGGGCGCCCGTACCAAACGGTCCGCAAGAAATTGCGGCCGTGGGCGCTTCCGGTGACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGAGATTGTCTCCGGGCTGTTCCCGCGGATGGAGAGGGGCTTTGAGCCCCCTTCCATGGGCACGCCACCACGCGATAGCGTGAACAGTGATGCCCCTGCTGAGGTGGTCCCTCTGAGCATATCGGAGGAGGAGATTCGTGCGGCCGTGTCGAGGATGCGGAGGAAGGACGCGGCCCCCGGCCCTGACGGTGTTCACGGCCGGGTCTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGGCTCGTGCGGCTCTTTGAAGCCTGCCTTGAGTCGGGACGGTTTCCGAAGCAGTGGAAGACGGGCAGACTTGTTCTACTAAGGAAGGAGGGACGCCCTGCGGACTCACCTGCAGGGTATCGTCCCATCGTGTTGCTGGACGAGGCGGGAAAACTGCTCGAGCGGGTGGTGGCTGCCCGCATCGTCCAGCACCTGACGGGGGTGGGTCCCGATCTGTCAGCGGAGCAGTTCGGATTCAGGGAGGGCCGCTGGACCATCGACGCGGTGATGCGCGTGCGCGCCCTCTCTGATGAGGCTGTCGGCCGGGGCGGGGTTGCACTGGCGGTGTCCTTGGACATCGCCAACGCGTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCTGCGTATCTCCGTCGGCTAGTCGGGTCCTACCGGACGGTGCTCCGCTTCCCCGTCGAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCTTGTGGAACATCAGCTATGACTGGGTCCTGCGGGGCGCCCTTAGCGCTCCTCTCCCGGGTCTGAGTGTAGTTTGCTACGCTGACGACACTTTGGTCGTGGCCCGGGGGAAGGATTTACGCGAGTCTGCCCGTCTTTCCTGTGCGGGTGTGGCCTTTGTCGTCGGCAGGATCCGAATGCTGGGTCTGGAGGTGGCGCTCGATAAATCCCAGGCCCTGTTGTTTCACGGGGCCCGGAGAGCGCCGCCTCAGGGGGCCCACCTCGTGATCGGAGGCGTTCGCGTCGAGATTGAGGCGACCGGGTTGGGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTCCGCGCTCACTTTGAAAGATTAGGTCCCCGACTGATGGCAGCCGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACGCGGTGGTGCGCCGCCTCTACACGGGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTATGGTGCCACGCCCTGACCCGCGACAACGTCGCGGCGTTGCGACGGCCACAGCGAGCGATTGCGGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTTCGCTCCAGGGGGGAGCCGCGTCCTGGCGCGGCGGAAGTTCGAGCGCGGAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCAGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGCTTCGGTCGCTACCTGCACCTTGTCGCCCGGAGGGAGCCGGCGTCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCTCCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCAACGAGTTCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGGGCCGGGGGTCGGAGGAAGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MAEWFIDIAIVAEPYFVPPDREDSWAGDVDGSVAIVMRQSAALPPLGMVARGSGYVVVRVDETVVIGVYFSPNRSLAEFERLLGGLEALVHRFESRPVILAGDLNAKCTAWGSPRTDSRDEFLSEWAFATGLCLLNKGSVATCVRWNGESHVDVSFASPSAARRVRGWRVLEGAETLSDHRFVRFELSVSTLLNAPAEDARGEEELPRSAPRSFPRWALKRLNKVLAVEAATVAAWAPMPARLVYVEVEAEWFRGTMRRVCDAAMPRVNGRAPRGGAYWWTPEIALLREECVRRSARHRRRRLRDADFAEVATRLHADCCQNQEALRRAIGEAKSQSMKTLLETLDQDPGGRPYQTVRKKLRPWALPVTERLQPQQLREIVSGLFPRMERGFEPPSMGTPPRDSVNSDAPAEVVPLSISEEEIRAAVSRMRRKDAAPGPDGVHGRVWDLAFGALGDRLVRLFEACLESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVQHLTGVGPDLSAEQFGFREGRWTIDAVMRVRALSDEAVGRGGVALAVSLDIANAFNTLPWSVIAGALEYHGVPAYLRRLVGSYRTVLRFPVERGVPQGSVLGPLLWNISYDWVLRGALSAPLPGLSVVCYADDTLVVARGKDLRESARLSCAGVAFVVGRIRMLGLEVALDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLGYLGLVLDGRWSFRAHFERLGPRLMAAAGSLSRLLPNVGGPDAVVRRLYTGVVRSMALYGAPVWCHALTRDNVAALRRPQRAIAAEALAADYAWRCDLRSRGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPASKCHHCSGCNEDTAEHTLAYCSAFAEQRRVLVAKIGPDLSLPTVVATMLGSNEFWQAMLDFCESTISQKEAAERERESSSSLSAPCRRRRAGGRRKAFVQLQPL

Summary

EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078935    BAC06462.1    + More
AB078929    BAC06452.1    AB078930    BAC06454.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KZ149896    PZC78733.1    AB078936    BAC06464.1    AGBW02011529    OWR46521.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01004272    KMQ92618.1    LBMM01006657    KMQ90417.1    LBMM01007036    KMQ90099.1    LBMM01008448    KMQ88867.1    LBMM01004634    KMQ92224.1    LBMM01015025    KMQ84953.1    LBMM01002052    KMQ95336.1    LBMM01014122    KMQ85315.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    LBMM01003988    KMQ92922.1    LBMM01004262    KMQ92649.1    LBMM01005474    KMQ91485.1    GGMR01015159    MBY27778.1    LBMM01008422    KMQ88894.1    LBMM01007425    KMQ89740.1    LBMM01015285    KMQ84870.1    ABLF02011238    ABLF02013358    ABLF02013361    ABLF02054869    ABLF02034925    GFXV01002090    MBW13895.1    LBMM01008445    KMQ88871.1    GGMR01006838    MBY19457.1    GALA01001777    JAA93075.1    LBMM01009535    KMQ88053.1    LBMM01002480    KMQ94776.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    ABLF02023257    AB090815    BAC57906.1    ABLF02041886    GFXV01003903    MBW15708.1    GGFJ01001369    MBW50510.1    LBMM01005465    KMQ91492.1    AB593325    BAK38646.1    GGFJ01001370    MBW50511.1    KQ971309    EEZ99146.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GALA01001776    JAA93076.1    GALA01000302    JAA94550.1    LBMM01006977    KMQ90149.1    KU543683    AMS38371.1    LBMM01004505    KMQ92346.1    AB593321    BAK38639.1    GGMR01019493    MBY32112.1    LBMM01005733    KMQ91252.1    GDAI01000741    JAI16862.1    GGFK01005660    MBW38981.1    LBMM01009610    KMQ87992.1    GGFJ01001439    MBW50580.1    KQ972691    KXZ75806.1    LBMM01008226    KMQ89040.1    ABLF02011183    ABLF02041884    KQ972226    KYB24577.1    KQ972544    KXZ75869.1    GGFL01004044    MBW68222.1    GAKP01002292    JAC56660.1    GGMR01004600    MBY17219.1    GFTR01008427    JAW07999.1    ABLF02041557    AB593323    BAK38643.1    GGFJ01001727    MBW50868.1    GGMR01012748    MBY25367.1    ABLF02018942    ABLF02041885    KXZ75807.1    AB593327    BAK38648.1    GGFJ01001453    MBW50594.1    GGFJ01001454    MBW50595.1    ABLF02009073    ABLF02030702    ABLF02042963    AJ278684    CAB99192.1    ABLF02027248    ABLF02014650    GGFL01001192    MBW65370.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF01553   Acyltransferase
PF00098   zf-CCHC
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR000663   Natr_peptide       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=7.46714e-08,     Score=140

Ontologies

Topology

Length:
1012
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03071
Exp number, first 60 AAs:
0.0019
Total prob of N-in:
0.00066
outside
1  -  1012
 
 

Population Genetic Test Statistics

Pi
189.419245
Theta
27.77108
Tajima's D
2.232799
CLR
0.12105
CSRT
0.917754112294385
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号