SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00933
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.328
 

Sequence

CDS
ATGATGGCAGACTTAACGAAAAAATTACCCCAGGAGGGTACCACTCTAGGTGGAGAATCCCTCCGTGCTTCCACCTCGGTGGGAGCATGCTGCCCCACGTATTCTGGGGGGGGCAAAGCATGCCACGATGAAGGGGGCTGTGCGACGGGCAGCGGAAAACCCGTCGAACTGAGGGAGACCCGCTCGGGGAAGGGCGCACCGTCACCGGCGCCGTCATCGGCGTCGATGTCTGTCGCCTCGCTGGACGGGCGGACGACAGAAGAGGAGGAGGGCGGTCTTCGGGACCCTGCCTTGGTCATAGGCAGGGCCATGAAGACCGTCAAGTCGTATGCGGCGACCAGTGCCAAAACCAAAGCTGCTGGCCGCAGGCTGCGGGAAGTCGTCTCGCGAGTCTCGAAGGTTCTGCCTTCGGTTGCTTCCGCCAATGACCAGGTGGTGCAGCTGATGGCGGAGAATTTGAGGCTCCGAGCACAGCTACAGGCGCAGCGGCGGCCCGATGACAAGGTTGCTGCTACCAAGCGGGTAGCCGCGACGAGGTCGTCGCCCGCGTTGCCACGTGCCGCTGGGTCGCGGACTCCTCCGGCATCTGTGCCGGCGGTGTCGCCGCTGGTCTCCGGGGTCCCTCGGGGTCCCTGTCCCTCAGCGGTGGCTGGCGACCCGTGGCCCGTGCTGCCACCATCGCGCGCGGTACAGCGGCGTTCGCGTCTCCCGTCGCCGCGGTCTAGGGAGGCGACGGCCGTCGAGCGGCAGCGGGGATCCGCGGGGCCACGGATCGTGGGCCTGCCGGAACCGAATTGCTACAGCCTGGACGAGATTATCGATCGCACCGTCCAGGCTGTAATGGAAAGGCTGGGTGGCGGGCTGGCGGCACTCGAAGCGAAACGTATTGTCGCTAGTGACGCTGAACGGCCTGCGTCTACACATGCCGCGGTGTCGGGTGCTGCAGTGACCCGCTCCACCCCCGTACAGGCTCCAGCCACTAGGGCGGGCCCGGGGCGAGACAGAGCCAAGCGGGGGGGCGGCGCTAACGCGAAGTGCACATCGCAAGCGCCTCAACCCCGTCCGCTGCCCCCGCCCCCGTCTAACATGGACGAGGGGTGGAATGTGGTGGCCCGGCGGGGTGCCAAGAGGGCCGTACCGACAGCTCCCCAAGTGGGTGGAGCACCGGCCACTGCGGCGTCTCAGGCTGCTCCCCAACAGGGTCGAGCGCCTGTGGCCGCCAAGAAAAAGAAGATGAAGAAGAAGTCGTCGCGCGCGCCGCGGTCGGCGGCAGTGGTCTTAACGCTGCTGCCGGCCGCCGAGGCCAAGGGCGTGTCATACGGAGATGTAGTCTCCCGGGCGCGCGCGGCTATTGATCTGGACGAGATCGGGGCGGGGGAGGGCCTCCGCTGTAGGCTGACGGCCAATGGGGCCAAGCTGCTAGAGTGTCCCGGTGCCGATAGTTCCGGCATCGCGGAGCGTCTGGCGGCGAAGCTCCGTACGGTTCTGCCTGAGGAAGAGGTTCGAGTGCACAGGCCGGTCAAAATGGCTGAATTGAGAGTGACCGGCCTGGACGACTGCACCACTAAGGATGAGGTGGCGGCGGCTATTGCCGCCCGGGGCAACTGCGCCCTGGAGAATATAACTGTAGGCGAGCTGCGCCTCGGTTATACCGGGGCTGGCTCTGTTTGGGTGCGTTGCCCGGTAGAGGCGGCCACCTCCTTGGCTGCTCCTCCGCCCGGTAGACCGTCGGGGGAACCGGGCAGGTTGCGCGTGGGCTGGATAGCGGCCCGCGTGCGCCTTCTCGAACCACGCGCCTGGCGGTGCCTCAGATGCTTCAGCACTGGGCACTGCCTCGCTAAATGCGCGAGTGCGGTTGACCGCAGCGGATTGTGCTTTCGCTGTGGTCAGCCTGGACACAAGGCGGCCGTGTGCTCGGCTGCGCCGCATTGCTTATTATGTGCGGCGGCCGGGCGCAAGGCTGACCACCGGGCCGGGGGCAAGGCCTGCCCTCCGGCCAGCAAGAATGCAGAACGAAATCGGCGCCGCCAAGCTAAGCGGCGTCAAAAGAAGCGGTTGGCCGGGGGAGCACCGGCCGGCACTTTGTCCCCCGCTGAGGCGTTCGCGCCCGATAGCGGGGGCAATGGAGTAGGGGAGGGAGCGATGGATGTGAAGAACCGCGATGGTCCCCCCCTGGCGATGGTGACCAGGGGCCCCGGGATCGTCGCGGTACAGTTAGAAAATATCGTCGTGATCGGGGTGTACTTTTCTCCGAATCGGCCTACCGTCGAGTTCGAGCGGTTCCTGGACGGGCTAGAGGTGATCGCTCGTCACCTCGCTCCCCGTTCAGTGATACTGGCGGGGGACTTCAATGCGAAGTCTGTCGCTTGGGGTTCCCCATTCACGGACGCTCGTGGTAGGCTGCTGGAGGAGTGGGCGGTCGCGGTCGGTCTCTGTATCGTTAATAGGGGCTCGATCGCGACTTGCGTGCGGTGGACGGGCGAGTCTATCGTGGACTTGACGTTCGCGAGCTCGCCCGTCGCACGGCGCATCCTCGGCTGGAGAGTGGTGGTGGGGGCGGAATCGTTGTCCGATCACCGGTATATCCGGTACGATCTTTCTGCCCCTGCGCCGACGCCGGCTGCAGGTGCCCGCGGGGTTGACCCCCCGCAGAGTGCATCCCGGTCATTCCCTAGGTGGGCACTGAAGCTCCTGAACAGGGAGCTCCTGGTGGAGGCCTCTATGGTGGCGGCGTGGGCGCCCAAGCGCCCACAACCTGTCGATGTGGAAACCGAGGCCGAATGGTTCCGGGGCGCGATGCACCGCATATGTGATGCCTCGATGCCCCGGGTCGGCTCTCGGCACTCTGGACGGCGACAGTCGCCCTGGTGGTCGCCCGAAATTGCAAGACTGCGTGCGGTCTCCATTCGGCGAGCCGCCGGTGCACTAGACACCGCCGACGCCCTGCGGCTGGCCATCAGGCGGGCCAAGGAGCAGAACATGGAGAGACTCTTGGAGGCGCTCGAAGCGGATCCGTGGGGGAGCCCATACAAATTGGTACGCGGCAAGTTGCGCCCGTGGGCCCCCTCTATGACTGAGCGTCTCCAGCCCCAGCAGCTGCGGGACATCGTTTCGGCGTTGTTCCCGCAGGAGCGGGAGGGTTTTGTCCCTCCCGCTATGGGCGGGCCGTCTGACATCGTCGACGGCCAAGCTCCTGCTGAGGTGCCCCGTATTACGGAGGCAGAGCTCCGGGTGGCCGTTGTCAAGATGACTGCGAAAGACACGGCCCCCGGCCCGGACGGAGTCCACGGCCGGGTATTGGCCTTGGCCCTCGGTGCCCTGGGGGACCGGCTCCTTGAGCTATATAATGGCTGCTTGGAGTCGGGACGGTTTCCGTCGCTCTGGCGGACGGGTAGACTTGTGTTGTTGAGGAAGGAGGGGCGCCCGGTGGATACAGCCGCCGGATATCGTCCTATCGTGCTGCTGGACGAGGCGGGAAAATTGCTGGAACGTATTCTGGCTGCCCGCATCGTTCGGCACCTGGTCGGGGTGGGGCCTGACCTGTCGGCGGAGCAGTACGGCTTCCGGGAGGGCCGTTCGACCGTGGATGCAATTCTTCGCGTGCGGTCCCTCTCGGACGAGGCCGTCTCTCGGGGGTCGGTTCTCGGCCCCCTCTTGTGGAATATCGGGTACGACTGGGTGCTGAGGGGCGCCCTCCTCCCGGGCCTCCGCGTTATTTGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGATGATTTTAGGGAGTCTGCCCGTCTCGCCACAGCGGGAGTGGCCCTCGTCGTCGGAAGGATAAGGAGGCTGGGTCTCGACGTGGCGCTCAATAAATCCGAGGCTCTGTGGTTTCACGGGCCGCGGAGGGCGCCACCCGTTGACACCCACATCGTGGTTGGAGGCGTCCGGATAGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCGTGTTGGACAGCCGATGGGCCTTTCGTGCTCACTTTGCGGAGCTGGTCCCCCGATTGATGGGGACGGCCGGTTCTTTGAGCCGGCTGCTCCCGAATATTGGGGGACCGGATCAGGTTGTGCGCCGTCTCTACGCGGGGGTGGTGCGATCGATGGCCCTGTACGGTGCACCTGTGTGGGCTGAGCCGCGCAACCGGGCCACTATGGCTCGGTTCCTGCGCCGGCCGCAGCGCACCGTTGCCATCAGGGTCATCCGCGGATATCGCACCGTCTCCTTCGAGGCGGCGTGTGTTTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGCGAGCTTCGTGCTCGGGGCGTGGCGCGTGTCCCCGAGAGTGAGCTGCGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACGTGGGGGCTACGGACCGTCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAGGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTCACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGTGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGAGTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGGAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MMADLTKKLPQEGTTLGGESLRASTSVGACCPTYSGGGKACHDEGGCATGSGKPVELRETRSGKGAPSPAPSSASMSVASLDGRTTEEEEGGLRDPALVIGRAMKTVKSYAATSAKTKAAGRRLREVVSRVSKVLPSVASANDQVVQLMAENLRLRAQLQAQRRPDDKVAATKRVAATRSSPALPRAAGSRTPPASVPAVSPLVSGVPRGPCPSAVAGDPWPVLPPSRAVQRRSRLPSPRSREATAVERQRGSAGPRIVGLPEPNCYSLDEIIDRTVQAVMERLGGGLAALEAKRIVASDAERPASTHAAVSGAAVTRSTPVQAPATRAGPGRDRAKRGGGANAKCTSQAPQPRPLPPPPSNMDEGWNVVARRGAKRAVPTAPQVGGAPATAASQAAPQQGRAPVAAKKKKMKKKSSRAPRSAAVVLTLLPAAEAKGVSYGDVVSRARAAIDLDEIGAGEGLRCRLTANGAKLLECPGADSSGIAERLAAKLRTVLPEEEVRVHRPVKMAELRVTGLDDCTTKDEVAAAIAARGNCALENITVGELRLGYTGAGSVWVRCPVEAATSLAAPPPGRPSGEPGRLRVGWIAARVRLLEPRAWRCLRCFSTGHCLAKCASAVDRSGLCFRCGQPGHKAAVCSAAPHCLLCAAAGRKADHRAGGKACPPASKNAERNRRRQAKRRQKKRLAGGAPAGTLSPAEAFAPDSGGNGVGEGAMDVKNRDGPPLAMVTRGPGIVAVQLENIVVIGVYFSPNRPTVEFERFLDGLEVIARHLAPRSVILAGDFNAKSVAWGSPFTDARGRLLEEWAVAVGLCIVNRGSIATCVRWTGESIVDLTFASSPVARRILGWRVVVGAESLSDHRYIRYDLSAPAPTPAAGARGVDPPQSASRSFPRWALKLLNRELLVEASMVAAWAPKRPQPVDVETEAEWFRGAMHRICDASMPRVGSRHSGRRQSPWWSPEIARLRAVSIRRAAGALDTADALRLAIRRAKEQNMERLLEALEADPWGSPYKLVRGKLRPWAPSMTERLQPQQLRDIVSALFPQEREGFVPPAMGGPSDIVDGQAPAEVPRITEAELRVAVVKMTAKDTAPGPDGVHGRVLALALGALGDRLLELYNGCLESGRFPSLWRTGRLVLLRKEGRPVDTAAGYRPIVLLDEAGKLLERILAARIVRHLVGVGPDLSAEQYGFREGRSTVDAILRVRSLSDEAVSRGSVLGPLLWNIGYDWVLRGALLPGLRVICYADDTLVVARGDDFRESARLATAGVALVVGRIRRLGLDVALNKSEALWFHGPRRAPPVDTHIVVGGVRIGVGVQLKYLGLVLDSRWAFRAHFAELVPRLMGTAGSLSRLLPNIGGPDQVVRRLYAGVVRSMALYGAPVWAEPRNRATMARFLRRPQRTVAIRVIRGYRTVSFEAACVLAGTPPWELEAESLAADYRWRSELRARGVARVPESELRARKAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPTTRCHHCGHDLDTAEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGSDESWKAMLDFCECTISQKEAAGRVRESSPHYAETRRRRAGGRDRGRIRDLAP

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D
PDB
1WDU     E-value=7.27186e-11,     Score=168

Ontologies

Topology

Length:
1629
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01144
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00006
outside
1  -  1629
 
 

Population Genetic Test Statistics

Pi
151.461093
Theta
109.154343
Tajima's D
0
CLR
186.925241
CSRT
0.367131643417829
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号