SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00932
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 1.001
 

Sequence

CDS
ATGAGACGGACTTGTGAAGGCTGGGATGGTGGAGTTACCATTGGTGGAGTAAAATTGACCAACCTCCGATACGCCGACGACACCAATCTTCTCGCGGCTAATGAAAGCGAGATGGCTGTTCTCATGAGCAAGCTTGAAAAAATTAGCCTCGAACTTGGTCTTGCCATTAACCGATCCAAAACAAAAGTAATGGTAATAGACCGCATGAACAAACTGGAGCACATGGGGTCACTGCATCTTGAAACAACAGAAAGATTCATATACCTGGGCTCCATGATTGCGAATACTGGATCGTGCGAGCCTGAGATTCGAAGACGTATCGGGATAGCAAAAACTGCCATGTCTCAGCTTGATAGCATCTGGTCCGATAGAAACATCTCCATAAAAACCAAGCGTAAACTTGTAACAAGTCTTGTGTTTTCTATTTTCTTATATGGGGCGGAGACATGGACTCTGAAGAAGGCTGATCGAAGTCAGATCGACGCGTTTGAGATGTGGTGCTGGAGGAAAATGCTGCGGATTCCCTGGACGGCGCATCGTACAAACGCATCAATCCTGGAAGAACTAGGCGTCTCCTTAAGACTCTCCACCATTTGCCTACGTAGGATTTTAGAGTTTTTCGGTCACGTTGCGAGAAAAAAGGGTGACAATCTCGAAAGACTTCTCATCACCGGCAAAGTGGAAGGAAAGAGGCCTAGGGGGCGTAGTCCCATGCGCTGGTCCGATCAGATCAAGACGACTTTGGAATCCAGCATCAATGTCGCTATCCACTGCGCGGAGGACAGAAGTGAATGGAAGAACATAGTCCTGACAAAAGTGCTCAGTAAAGGTCACGACCCTCAGAACTGA
Protein
MRRTCEGWDGGVTIGGVKLTNLRYADDTNLLAANESEMAVLMSKLEKISLELGLAINRSKTKVMVIDRMNKLEHMGSLHLETTERFIYLGSMIANTGSCEPEIRRRIGIAKTAMSQLDSIWSDRNISIKTKRKLVTSLVFSIFLYGAETWTLKKADRSQIDAFEMWCWRKMLRIPWTAHRTNASILEELGVSLRLSTICLRRILEFFGHVARKKGDNLERLLITGKVEGKRPRGRSPMRWSDQIKTTLESSINVAIHCAEDRSEWKNIVLTKVLSKGHDPQN

Summary

EMBL
FJ265548    ADI61816.1    ODYU01004401    SOQ44236.1    FJ265553    ADI61821.1    + More
FJ265557    ADI61825.1    FJ265546    ADI61814.1    KZ150203    PZC72267.1    FJ265547    ADI61815.1    FJ265552    ADI61820.1    FJ265560    ADI61828.1    GU815090    ADF18553.1    MRZV01002322    PIK33998.1    MRZV01000196    PIK55924.1    MRZV01001207    PIK39730.1    AHAT01022938    MKPU01000878    OIR55924.1    BDSA01000081    GBE63537.1    LK055282    CDR71995.1    AAGJ04055194    LK054988    CDR71535.1    HACG01049251    HACG01049252    CEK96116.1    CEK96117.1    AJ132772    CAA10770.1    GBBM01006298    JAC29120.1    AFYH01119920    NWSH01002736    PCG67606.1    HACG01049245    CEK96110.1    GDHC01017214    JAQ01415.1    AMGL01091659    AMGL01091660    AMGL01091661    AMGL01091662    AMGL01091663    AMGL01091664    AMGL01091665    AMGL01091666    AMGL01091667    AMGL01091668    MRZV01001216    PIK39650.1    MRZV01000994    PIK41715.1    BART01031562    GAH15691.1    AAGJ04075245    AHAT01008485    AAGJ04167631    AAGJ04128321    QIAP01000240    PYX61602.1    GU815089    ADF18552.1    AHAT01017643    AHAT01022314    GGMR01016842    MBY29461.1    AHAT01013219    LBMM01001656    KMQ95932.1    GGMR01018096    MBY30715.1    GBHO01020011    GDHC01013600    JAG23593.1    JAQ05029.1    HACG01049248    HACG01049253    CEK96113.1    CEK96118.1    GGMS01004979    MBY74182.1    AAGJ04171899    HACG01049255    CEK96120.1    LBMM01003995    KMQ92919.1    PDHN01000302    PGH39547.1    AHAT01009145    GGMS01001437    MBY70640.1    AAGJ04161766    MRZV01002544    PIK33458.1    GBHO01034555    JAG09049.1    GDRN01098129    JAI59014.1    GBHO01028834    JAG14770.1    HACG01049244    HACG01049247    CEK96109.1    CEK96112.1    GBHO01033031    GBHO01015473    GBHO01015472    GBHO01015471    GBHO01015469    GBHO01013134    GBHO01013133    GBHO01013129    GBHO01013128    JAG10573.1    JAG28131.1    JAG28132.1    JAG28133.1    JAG28135.1    JAG30470.1    JAG30471.1    JAG30475.1    JAG30476.1    AAGJ04122993    AAGJ04093867    GDHC01004555    JAQ14074.1    GGMS01006790    MBY75993.1    HACG01049249    CEK96114.1    GDHC01007098    GDHC01001590    JAQ11531.1    JAQ17039.1    NWSH01000469    PCG76200.1    AHAT01016497    ABLF02038495    MRZV01002526    PIK33493.1    AAGJ04118689    AAGJ04161747    AFYH01053121    ABLF02046942    ABLF02059971    AAGJ04165736    ABLF02042206    GGMS01001369    MBY70572.1    KF881087    AIJ27486.1    NEVH01007405    PNF35773.1    NEVH01004413    PNF39563.1    AHAT01013157    AHAT01013158   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR002138   Pept_C14_p10       
IPR000637   HMGI/Y_DNA-bd_CS       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
282
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
6.63721
Exp number, first 60 AAs:
0.00245
Total prob of N-in:
0.41075
outside
1  -  282
 
 

Population Genetic Test Statistics

Pi
319.699137
Theta
172.777039
Tajima's D
2.659689
CLR
12.92772
CSRT
0.958002099895005
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号