SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00929
Annotation
reverse_transcriptase_[Lasius_niger]
Full name
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.97 Nuclear   Reliability : 2.317
 

Sequence

CDS
ATGCACCCAGATGGCTCCGCCCACGGAGGAAGTGCAATTATAATCAGAAGTAACATCAAGCACTATGAAGGATCTCATTACTGTACTGATATAATACAAGCAACAAACATCGTTGTTCAAGACTGGGTGGGACCCATCACCATATCGGCACTTTACAGCCCTCCAAAACATAACATTAAGAATGAAGATTATGAAAAGTTTTTTAATTCCTTAGGACATAGATTTATGGCTGGTGGAGATTATAATGCTAAGCATACAAGCTGGGGGTCTCGAACTGTGACAACGAAGGGAAGACAGTTACTTTCTTGCATTGAACGACTAAGATTAAATGTTTGTTCAACTGGCGAGCCAACATATTGGCCGAGTGACAAAAGGAAGGTACCAGACTTGTTAGATTTTTGTATCACAAAAGGCATCAATAATGCATGTATAGAGTGTACATCCAGTTTTGATCTCTCATCTGATCACTCCCCAGTCATAATAACGCTCAGTCGAAATATAGCCAGGAAAATGAAAACATGTAGACTGCATTCTTGCAGGACCGATTGGGATTACTTTCGTGTATTGGTATCTGGCTCTTTGGACATCAATCTACCTCTAAAAACAGAGGATGACATTGCGGATGGTGTTGAACATTTTAACTTTGTTGTACAACATTCTGCTTGGCATGCGACACCCGCCCCACCAATTGTAAAACCATCGCAATGTTCTCTTTCAATCAAAACGTTGTTATCAGAAAAAAGGCGATTAAGAAAACGATGGCAAACTACGAGGCATCCTGATGACAAAAAAATATTTAATTACAGTATTACAAAATTGAAAATACATTTGGCTCGTGAGAGAAACGAAAAAACAAATACATATATGCAAGAGCTGGATGCCACATCGAAAACAGACTATTCGCTATGGAAGGCTACCAAATACCTTAAACGTCCTATAAACCACCAACCTCCTCTACGGAAATCTGATGGAACTTGGGCCACTAGCGACCTAGACAAAGCTAAGGCCTTTGCTGAACACCTGGATAATGTATTTACACTAAATGCGATGGATAATTCGGCTATGCCTGCCAATGAATCGGAATTGAATGAGCATGTTATTGAGGTTCCCTTCAAAAAAATTCGTAAATCCGAAACAAGATCTGTCATAAAGAATCTTGACCCTAATAAATCACCAGGATATGATCTAATAACAGCAACTATTTTAAAAGAGTTACCTCAAGAGGGAATTACTTTCTTGACCCAATTATACAATGCTATTTTCAGACTTAAGTTTGTGCCTCACTTATGGAAGGTAGCTCAAATTAAGATGATACCTAAACCTGGAAAAAGTGGCGAGGACGTGAAATCTTATCGTCCTATCAGTTTGCTCCCTGTACCGTCCAAGGTCATGGAGATTCTGTTTCTCGCAAGATTGAATCCTATTATTGAAACGAAAAAACTAATCCCAGATCATCAGTTTGGCTTTAGATGGAAACATAGTACAATCGAACAAATTCACAGACTTGTTGAATATATTAATAGAGCTTTTGAGGGAAAAAAATACTGCACGGCTGCCTTCCTAGATATATCTCAGGCCTTCGACCGAGTTTGGCATGAAGGACTCTTACTCAAAATTAAAAAGAAGATCCCTTCCAACTTCTATTTTTTCATTGAATCTTATTTGAGTAGCCGATATTATTTTGTTAAACACGGCGATGAAATATCGCCTCTCCATTCAATTAATGCCGGTGTTCCCCAAGGCAGTGTCATTGGGCCCACTTTATATCTATTGTATACAGCTGATTTGCCCGAAACTGATGGTACGATAATGGGAACTTTTGCTGATGACACCGCAATAATGACCATGGACGATGATCCAAACGAAGCTTCTTATAAACTACAGAACAGCCTTAATAATATCAACACTTGGCTAAAAAAATGGCGTATCAAAGCGAATGAATCTAAGTCTGTACAAGTTACTTTCACCACTCGAAGACAAACTTGTCCCGCAGTCACCTTGAATAATATAGAGATCCCGCAATCTGAAAATGCAAAGTACTTAGGGATGTACCTGGATAGGAGACTGACTTGGAGAAAACATATATTCACCAAGCGTCTTGCGGTGGGTCAGCAAATACGTAAATTGTATTGGCTTCTTAATAGAAAGTCTCAACTGTCAGTTGAAAACAAGCTTTTACTATACAAATCTGTTATTAAACCCATTTGGTCATATGGCATCCAATTGTGGGGTACTGCGTCAAACTCAAATATTGAAATACTTCAAAGATTTCAATCAAAAACGCTCAGGATGATAGTGAACGCACCATGGTATGTTACAAATGAAAGAATCCATTATGATCTTGCCATAAGAAAAGTCAAACATGAAGTAATCCATCGAGCTAAAGCATATTGTGTAAGATTGGAAGCCCATCCGAATAACCTTGCTAAGCATTTAATGGACAACCTAATGACTACTAGAAGACTCAGAAGAAGAGTGCCTCAAGATCTACTAGATCTACTGTAG
Protein
MHPDGSAHGGSAIIIRSNIKHYEGSHYCTDIIQATNIVVQDWVGPITISALYSPPKHNIKNEDYEKFFNSLGHRFMAGGDYNAKHTSWGSRTVTTKGRQLLSCIERLRLNVCSTGEPTYWPSDKRKVPDLLDFCITKGINNACIECTSSFDLSSDHSPVIITLSRNIARKMKTCRLHSCRTDWDYFRVLVSGSLDINLPLKTEDDIADGVEHFNFVVQHSAWHATPAPPIVKPSQCSLSIKTLLSEKRRLRKRWQTTRHPDDKKIFNYSITKLKIHLARERNEKTNTYMQELDATSKTDYSLWKATKYLKRPINHQPPLRKSDGTWATSDLDKAKAFAEHLDNVFTLNAMDNSAMPANESELNEHVIEVPFKKIRKSETRSVIKNLDPNKSPGYDLITATILKELPQEGITFLTQLYNAIFRLKFVPHLWKVAQIKMIPKPGKSGEDVKSYRPISLLPVPSKVMEILFLARLNPIIETKKLIPDHQFGFRWKHSTIEQIHRLVEYINRAFEGKKYCTAAFLDISQAFDRVWHEGLLLKIKKKIPSNFYFFIESYLSSRYYFVKHGDEISPLHSINAGVPQGSVIGPTLYLLYTADLPETDGTIMGTFADDTAIMTMDDDPNEASYKLQNSLNNINTWLKKWRIKANESKSVQVTFTTRRQTCPAVTLNNIEIPQSENAKYLGMYLDRRLTWRKHIFTKRLAVGQQIRKLYWLLNRKSQLSVENKLLLYKSVIKPIWSYGIQLWGTASNSNIEILQRFQSKTLRMIVNAPWYVTNERIHYDLAIRKVKHEVIHRAKAYCVRLEAHPNNLAKHLMDNLMTTRRLRRRVPQDLLDLL

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
LBMM01013518    KMQ85605.1    NEVH01007402    PNF35856.1    NEVH01016340    PNF25410.1    + More
NEVH01015305    PNF27092.1    NEVH01021925    PNF19341.1    NEVH01006736    PNF36716.1    NEVH01008277    PNF34262.1    NEVH01001347    PNF42959.1    NEVH01023979    PNF17579.1    NEVH01020940    PNF20481.1    NEVH01016302    PNF25823.1    NWSH01000032    PCG80496.1    NWSH01007753    PCG62823.1    NEVH01019963    PNF22185.1    LBMM01014395    KMQ85192.1    NEVH01026386    PNF14434.1    ABLF02041861    GEZM01084969    JAV60363.1    GEZM01053022    JAV74219.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01005295    PNF38784.1    LBMM01012078    KMQ86419.1    KU543673    AMS38352.1    GEDC01000337    JAS36961.1    KU543687    AMS38379.1    NEVH01020963    PNF20308.1    GAKP01017773    JAC41179.1    AY508487    AAS13459.1    X17551    CAA35587.1    LBMM01012041    KMQ86458.1    KU543685    AMS38375.1    AY047531    AAK77263.1    CP012527    ALC48130.1    M17214    AAA28508.1    GFTR01008261    JAW08165.1    DNOY01000259    HBE18313.1    GFDF01007661    JAV06423.1    LBMM01006314    KMQ90710.1    GBGD01000389    JAC88500.1    GFTR01008254    JAW08172.1    GECL01003538    JAP02586.1    GGMR01003407    MBY16026.1    GBHO01008295    JAG35309.1    GGMR01000676    MBY13295.1    GFTR01008151    JAW08275.1    NEVH01006721    PNF37225.1    GFTR01008257    JAW08169.1    GFTR01008269    JAW08157.1    GBBI01003747    JAC14965.1    GGMR01000226    MBY12845.1    GFTR01008169    JAW08257.1    ABLF02016613    GGMR01016905    MBY29524.1    GGMR01012305    MBY24924.1    GGMR01003864    MBY16483.1    GFTR01008251    JAW08175.1    GFTR01008246    JAW08180.1    GFTR01008260    JAW08166.1    GFTR01008271    JAW08155.1    GGMR01012443    MBY25062.1    GFTR01008256    JAW08170.1    GGMR01006491    MBY19110.1    GGMS01017365    MBY86568.1    GFXV01002840    MBW14645.1    GGMR01016296    MBY28915.1    GFXV01000908    MBW12713.1    LBMM01015125    KMQ84919.1    GGMR01012283    MBY24902.1    GBBI01003810    JAC14902.1    GGMR01020516    MBY33135.1    GGMS01006655    MBY75858.1    GGMR01012676    MBY25295.1    GGMR01011511    MBY24130.1    GEZM01021881    JAV88842.1    GDHC01020244    JAP98384.1    ABLF02024784    ABLF02024792    ABLF02034460    GGMR01005022    MBY17641.1    GDHC01018248    JAQ00381.1    GFTR01007997    JAW08429.1    GEDC01029594    JAS07704.1    ABLF02014118    ABLF02014121    ABLF02054790    GGMS01006359    MBY75562.1    AF237761    AAF81411.1    GGMR01013409    MBY26028.1    ABLF02017755    ABLF02044739    ABLF02063495    ABLF02065698    ABLF02066197    GGMR01006408    MBY19027.1    ABLF02021819    ABLF02021820    ABLF02055326    GFTR01007929    JAW08497.1    ABLF02017668    ABLF02021394    ABLF02055728    GGMR01000857    MBY13476.1    ABLF02023279    ABLF02041474    ABLF02025048    ABLF02063033    GGMR01014053    MBY26672.1    ABLF02040174    ABLF02040183    ABLF02055266    GGMS01002786    MBY71989.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
1WDU     E-value=0.00225748,     Score=100

Ontologies

Topology

Length:
834
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01699
Exp number, first 60 AAs:
0.00072
Total prob of N-in:
0.00005
outside
1  -  834
 
 

Population Genetic Test Statistics

Pi
60.160686
Theta
150.554297
Tajima's D
-1.186091
CLR
140.585461
CSRT
0.104994750262487
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号