SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00905  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA009779
Annotation
PREDICTED:_unconventional_myosin-Va_[Bombyx_mori]
Full name
Unconventional myosin-Vb       + More
Unconventional myosin-Va      
Alternative Name
Dilute myosin heavy chain, non-muscle
Myosin heavy chain p190
Myosin-V
Location in the cell
Cytoplasmic   Reliability : 1.941
 

Sequence

CDS
ATGACAACGAAGGAATTGTACACGAAGGGTGCCAGGATATGGGTGGAGCACCCGGAGAAGGTGTGGGAGAGCGCAACAGTAACATCCGACTATCGATCCGGCGTTCTCATCGTGAAACTAGACCAGACAGATGAAATAAGACAAATAACGATCAAAGATGAGAAACACATGCCCCCACTCCGGAACCCGTCGCTCCTCATCGGCCAAAATGATCTCACGTCACTATCGTACCTCCACGAGCCGGCGGTGCTGCATAATCTTAAAGTCAGATTCTGCGATCGTAACGCTATATACACCTACTGCGGGATCGTCCTCGTGGCCATCAATCCTTATTATGATCTTCCGATTTACGGCGATGAAACCATCATGGCGTATCGGGGCCAATCGATGGGCGATCTGGACCCTCACATATTCGCCGTCTCCGAAGAGGCCTACACCAAACTGGAGCGAGAAAGGAGTGATCAGAGTATCATAGTCAGCGGCGAGTCCGGTGCCGGGAAGACGGTGTCGGCAAAGTACGCCATGCGATACTTCGCAGCTGTCGGCGGCAACGTTAGCGAAACCCAGATCGAGAGGAAAGTGCTGGCTTCAAGTCCCATCATGGAGGCGATAGGCAATGCGAAGACAACCCGTAACGACAACTCATCGCGCTTCGGCAAGTTCATAGAGATACACTTCGACAGCCAGTACCGGATATCCGGGGCCAGCATGCGCACGTACCTGCTCGAGAAGTCGAGGGTGGTGTACCAGAGTCCCGGCGAGAGGAACTACCATATATTCTATCAGCTGTGTGCCGCTTCTGCTTTGATGCCTCATCTGAAGTTGGAACATCAAGACACATTACACTATTTGAATCAAGGCGGCAGTCCGAATATCGACGGAGTGGATGATCTAAAAGCTTTCAACGAAACTAGAAGCGCTTTAACTACTTTAGGCGTTACGGATTCGGAGCAGAGGGACATGTTCACCATCCTGGCCGCGATACTGCATCTCGGCAACGTCGCGCTGCTGTCCGAGGACCCCGACGCGGCGCCCGGAGCAGACTGCGAGGACGGAGCCTACATCAGCCCGACAGACGAGCACCTGACGCACGCGTGTTCGCTGCTGGGAGTGTCGCGCTTGGAGCTGTCGCGGTGGCTGAGTCATCGCCGCATCGCCTCCGCCCACGAGGTCATCGTCGCCAGGCTGGACGTGCAGCGCGCGGCGTGCGCCCGGGACGCGCTCGCCAAGAAGCTGTACGGGGAGCTGTTCGCGTGGCTCGTCACCGCAGTCAACCGCGCGCTCGACACCGGACACGCCAAGAAACACTTCATCGGCGTCCTCGACATCTACGGCTTCGAGACCTTCGAAATCAACTCGTTCGAACAGTTCTGCATCAACTACGCGAACGAGAAGCTCCAGCAGCAGTTCAACTCGCACGTGTTCAAACTCGAGCAGGACGAATATATAAAGGAAGAGATCTCGTGGGAGATGATTGACTTCTACGACAACCAGCCGTGCATAGACCTGATCGAGGACCGTCTGGGTGTCCTGGCGCTGCTCGACGAGGAGTGCCGCGTGCCGCAGGGCTCCGACACCGGCTTCGTGGCCAAGCTGCACCAGAAGTGCGCCGCCTACCCGCACTTCATGAAGCCGAGGTTCGGGAACCAGGCCTTCATAATAAAGCATTTCGCTGACAACGTGGAGTACCAGTCCGGCGGTTTCCTTGAGAAGAATCGTGACACAGTGTCGGAGGAACAGCTGGAGTGCATCAGGACAGCCACCAGCTGCCGCCTCATACACGTCATGCTGGAGTCGGAGCGCGCGGTAGACCGTCAGACCGCGACCCTGCCGCCGCCCTCCCGGAGGAGGACCACGCCCTCCGTGCCGATAACGAGTCTAACTAAAATCCAACTCAAAAATAGAAAATAA
Protein
MTTKELYTKGARIWVEHPEKVWESATVTSDYRSGVLIVKLDQTDEIRQITIKDEKHMPPLRNPSLLIGQNDLTSLSYLHEPAVLHNLKVRFCDRNAIYTYCGIVLVAINPYYDLPIYGDETIMAYRGQSMGDLDPHIFAVSEEAYTKLERERSDQSIIVSGESGAGKTVSAKYAMRYFAAVGGNVSETQIERKVLASSPIMEAIGNAKTTRNDNSSRFGKFIEIHFDSQYRISGASMRTYLLEKSRVVYQSPGERNYHIFYQLCAASALMPHLKLEHQDTLHYLNQGGSPNIDGVDDLKAFNETRSALTTLGVTDSEQRDMFTILAAILHLGNVALLSEDPDAAPGADCEDGAYISPTDEHLTHACSLLGVSRLELSRWLSHRRIASAHEVIVARLDVQRAACARDALAKKLYGELFAWLVTAVNRALDTGHAKKHFIGVLDIYGFETFEINSFEQFCINYANEKLQQQFNSHVFKLEQDEYIKEEISWEMIDFYDNQPCIDLIEDRLGVLALLDEECRVPQGSDTGFVAKLHQKCAAYPHFMKPRFGNQAFIIKHFADNVEYQSGGFLEKNRDTVSEEQLECIRTATSCRLIHVMLESERAVDRQTATLPPPSRRRTTPSVPITSLTKIQLKNRK

Summary

Description
May be involved in vesicular trafficking via its association with the CART complex. The CART complex is necessary for efficient transferrin receptor recycling but not for EGFR degradation. Required in a complex with RAB11A and RAB11FIP2 for the transport of NPC1L1 to the plasma membrane. Together with RAB11A participates in CFTR trafficking to the plasma membrane and TF (transferrin) recycling in nonpolarized cells. Together with RAB11A and RAB8A participates in epithelial cell polarization. Together with RAB25 regulates transcytosis.
Processive actin-based motor that can move in large steps approximating the 36-nm pseudo-repeat of the actin filament. Involved in melanosome transport. Also mediates the transport of vesicles to the plasma membrane. May also be required for some polarization process involved in dendrite formation (By similarity).
Subunit
Component of the CART complex, at least composed of ACTN4, HGS/HRS, MYO5B and TRIM3. Interacts with RAB11FIP2 (By similarity). Interacts with RAB11A and RAB8A (By similarity). Found in a complex with CFTR and RAB11A (By similarity). Interacts with NPC1L1 (By similarity). Interacts with LIMA1 (PubMed:29880681).
May be a homodimer, which associates with multiple calmodulin or myosin light chains.
Similarity
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Myosin family.
Keywords
Actin-binding   Alternative splicing   ATP-binding   Calmodulin-binding   Coiled coil   Complete proteome   Cytoplasm   Motor protein   Myosin   Nucleotide-binding   Phosphoprotein   Protein transport   Reference proteome   Repeat   Transport   3D-structure   Direct protein sequencing   Golgi apparatus   Membrane  
Feature
chain  Unconventional myosin-Vb
splice variant  In isoform 3.
EMBL
BABH01017761    BABH01017762    KQ459593    KPI96618.1    ODYU01000382    SOQ35071.1    + More
KQ971354    EFA06975.2    GALX01002476    JAB65990.1    AAZX01001194    GECZ01014290    JAS55479.1    KQ977279    KYN04261.1    JR039293    JR039294    AEY58619.1    AEY58620.1    QOIP01000009    RLU18383.1    ADTU01022924    ADTU01022925    GEZM01031022    JAV85121.1    KQ434822    KZC07080.1    GL440553    EFN65790.1    NNAY01000532    OXU27842.1    KQ435896    KOX69324.1    LBMM01000310    KMR01422.1    KQ981382    KYN42143.1    GECU01024162    JAS83544.1    KZ288326    PBC27980.1    KQ982652    KYQ52811.1    KQ414646    KOC66513.1    KOC66516.1    KQ980934    KYN11323.1    GL436993    EFN71292.1    KK107148    EZA57445.1    GL445235    EFN90001.1    GDRN01089957    JAI60556.1    GDRN01089955    JAI60557.1    HM212671    ADM15669.1    KB632326    ERL92471.1    APGK01035149    APGK01035150    APGK01035151    KB740923    ENN78188.1    LN830727    CFW94236.1    GBYB01003692    JAG73459.1    GBYB01006959    JAG76726.1    AXCN02000461    DS235019    EEB10549.1    KQ976464    KYM84426.1    AXCM01004568    GBXI01010584    JAD03708.1    GBXI01008248    JAD06044.1    GDHF01005267    JAI47047.1    GDHF01029304    JAI23010.1    HACA01031851    CDW49212.1    GAMC01013037    JAB93518.1    GAMC01013038    JAB93517.1    GDIQ01141357    JAL10369.1    GDIP01235456    JAI87945.1    GDIQ01018624    JAN76113.1    GDIQ01041893    JAN52844.1    GDIQ01170346    GDIQ01136811    GDIQ01030299    LRGB01003163    JAK81379.1    KZS03930.1    GDIP01088479    JAM15236.1    GDIQ01214230    JAK37495.1    GDIP01096726    JAM06989.1    GDIQ01108817    JAL42909.1    GDIQ01106568    JAL45158.1    GDIQ01106515    JAL45211.1    OUUW01000001    SPP75705.1    GDIP01140471    JAL63243.1    GL732599    EFX72449.1    SPP75704.1    GBRD01010430    GBRD01007165    JAG55394.1    GBHO01000214    GBHO01000213    JAG43390.1    JAG43391.1    GDIQ01090022    JAN04715.1    GBXI01007769    JAD06523.1    GDIQ01061683    JAN33054.1    CH933808    KRG04531.1    EDW09224.1    GDHF01001133    JAI51181.1    CM004466    OCU02687.1    GFDL01001250    JAV33795.1    CH479223    EDW35042.1    CH916367    EDW02584.1    BC011494    BC046444    BC118525    AK173102    M55253    CM000071    EAL25983.2    ENO01762.2    LJIG01002798    KRT84142.1    KRG04530.1    AAMC01059172    AAMC01059173    AAMC01059174    AAMC01059175    AAMC01059176    AAMC01059177    AAMC01059178    AAMC01059179    JXUM01047023    JXUM01047024    JXUM01047025    JXUM01047026    JXUM01047027    JXUM01047028    X67251    Z11718    GDIP01017260    JAM86455.1    APCN01002280    AAPE02009051    AAPE02009052    GEDC01028278    GEDC01006987    JAS09020.1    JAS30311.1    GGFL01003159    MBW67337.1    AC147992    AC148001    AC148002    CH466528    EDL09524.1    AAAB01008960    EAA11777.4    EDL09522.1    JRES01000780    KNC28384.1   
Pfam
PF00063   Myosin_head        + More
PF00612   IQ
PF01843   DIL
PF02736   Myosin_N
Interpro
IPR027417   P-loop_NTPase        + More
IPR036103   MYSc_Myo5       
IPR001609   Myosin_head_motor_dom       
IPR008989   Myosin_S1_N       
IPR000048   IQ_motif_EF-hand-BS       
IPR036961   Kinesin_motor_dom_sf       
IPR004009   Myosin_N       
IPR002710   Dilute_dom       
IPR037990   Myo5b_CBD       
IPR037988   Myo5a_CBD       
SUPFAM
SSF50084   SSF50084        + More
SSF52540   SSF52540       
Gene 3D
PDB
1W7J     E-value=0,     Score=1925

Ontologies

Topology

Subcellular location
Cytoplasm  
Golgi apparatus membrane  
Length:
636
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
13.60193
Exp number, first 60 AAs:
0
Total prob of N-in:
0.63503
outside
1  -  636
 
 

Population Genetic Test Statistics

Pi
414.000504
Theta
185.101712
Tajima's D
2.723521
CLR
0.260582
CSRT
0.964551772411379
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号