SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00894
Annotation
PREDICTED:_uncharacterized_protein_LOC101737183_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.253 PlasmaMembrane   Reliability : 1.104
 

Sequence

CDS
ATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGTGCTTTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGACTACGACGGCGAAGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTTCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGATGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGACTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGATATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACATAGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACTGGACATGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGAGGTGCCCTCCTCCCGGGCCTGAGCGTAATATGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATTAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTGGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATAGGTGGCGGGCTGAACTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCACGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTTACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAACCGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MRPWAPPITERLQPQQLRDIVSVLFPQEREGFVAPAMDAPPDYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHRVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYRWRAELRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRITAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGTDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KQ460685    KPJ12887.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01006657    KMQ90417.1    LBMM01004272    KMQ92618.1    LBMM01005733    KMQ91252.1    LBMM01005948    KMQ91066.1    LBMM01002052    KMQ95336.1    LBMM01006063    KMQ90967.1    LBMM01007036    KMQ90099.1    LBMM01008422    KMQ88894.1    LBMM01008448    KMQ88867.1    LBMM01008682    KMQ88705.1    LBMM01002480    KMQ94776.1    GGMR01014195    MBY26814.1    LBMM01015018    KMQ84954.1    GGMR01000779    MBY13398.1    LBMM01003988    KMQ92922.1    LBMM01004634    KMQ92224.1    LBMM01007425    KMQ89740.1    LBMM01019839    KMQ83438.1    LBMM01015025    KMQ84953.1    LBMM01019838    KMQ83439.1    LBMM01004505    KMQ92346.1    LBMM01012412    KMQ86235.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01014122    KMQ85315.1    LBMM01008278    KMQ89009.1    ABLF02011238    LBMM01005474    KMQ91485.1    LBMM01003245    KMQ93755.1    GGMR01015159    MBY27778.1    LBMM01005465    KMQ91492.1    LBMM01003575    KMQ93366.1    KMQ94772.1    LBMM01006725    KMQ90373.1    GFXV01002090    MBW13895.1    GGMR01004600    MBY17219.1    ABLF02034925    ABLF02013358    ABLF02013361    ABLF02054869    LBMM01004262    KMQ92649.1    LBMM01005216    KMQ91703.1    ABLF02041886    GGMR01011682    MBY24301.1    LBMM01004261    KMQ92650.1    GGMR01006838    MBY19457.1    ABLF02005203    ABLF02041316    ABLF02011183    ABLF02041884    LBMM01014956    KMQ84982.1    GFXV01003903    MBW15708.1    ABLF02010223    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GGFJ01001439    MBW50580.1    GGMR01015354    MBY27973.1    ABLF02041557    GGFJ01001727    MBW50868.1    ABLF02004854    ABLF02041317    ABLF02018942    ABLF02041885    GGFJ01001370    MBW50511.1    GGFJ01001369    MBW50510.1    LBMM01015285    KMQ84870.1    GGFL01001583    MBW65761.1    KU543683    AMS38371.1    ABLF02018808    GGFL01004044    MBW68222.1    GALA01001777    JAA93075.1    GAPW01000192    JAC13406.1    GEHC01000915    JAV46730.1    GALA01001776    JAA93076.1    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    GAKP01002292    JAC56660.1    ABLF02009991    ABLF02009992    ABLF02054952    GALA01000302    JAA94550.1    ABLF02059310    ABLF02004597    ABLF02041324    GGMR01009778    MBY22397.1    GGFK01005660    MBW38981.1    GEHC01000964    JAV46681.1    ABLF02023257    ABLF02007989   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=2.53897e-05,     Score=116

Ontologies

Topology

Length:
675
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17851
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00101
outside
1  -  675
 
 

Population Genetic Test Statistics

Pi
5.371643
Theta
42.114608
Tajima's D
1.378345
CLR
0.663783
CSRT
0.761661916904155
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号