SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00876
Pre Gene Modal
BGIBMGA009767
Annotation
PREDICTED:_phosphatidylinositol_4-phosphate_5-kinase_type-1_gamma_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.554
 

Sequence

CDS
ATGCACCAGAAATACGACCTCAAAGGGTCCACGTACAAACGTAAGGCAAGCAAAACAGAACGACAGAAAACCTCACCGACCTACAAGGATCTCGACTTCATGGAGCATCACAACGAGGGGATATTTCTGGAAGCGGACACGTACACGGCTTTGATAAAAACGATGCAGCGTGATTGTCGTGTATTGGAGAGCTTCAAGATCATGGACTACTCCCTCCTGGTCGGCATACATAACTTAGATGACGCCCAGCGCGAGAAGAACGAAGCCAGGAAACTGACGGAATCCGGTCAGAGCGATGGTGAGGATAACGAAGGGGAGACCAAGAGAACTGGACTCAATCGAACGAGATCCGAAGCCAGGGAGGATTTCGGGATCCAAGTTAAAAGGACACAATCGATAAACCGACAGCGTCTGGTCGCGCACTCGACAGCCATGGAGAGCATACAGGCGGAAAGCGAGCCCATAGATGAGGAGGAAGATGTCCCGTCCGGCGGCATCCCGGCCCGGAACGCGCGTGGCGAGCGTCTGCTGCTGTTCCTGGGCATCATCGACATACTCCAGTCGTATCGTCTCCGGAAGAAGCTCGAGCACACTTGGAAGAGCATGATACACGATGGCGACACTGTATCGGTCCACAGACCCAGCTTCTACGCTCAGAGATTCTTAGATTTCATGGCTAAAACCGTTTTCAAGAAGATACCTTCGTTGGACCTGCCGGAAATCAAGGGCAACCACAGGAAGTTCCGAACCCTCGTCACTAGTTACATAGCCCTGAAACACTCTCCTTCGAAGCGGAAGAGCATCGCGAAGCCGTCGCGGCCACAAGAGGAAATCGATACGCCAGGACGCTTCATCGGGCGACCTATCAAAGATTACAATCCGGAATATCTGAGACAGGCCCGACTGTCGCCCAGGTCTTCGGTACGTTCTAGCATGAGCGATTTTACCGATACGACCATATCGACGTGGAACCAGCGTCACCCGCCCGCGCCCGCCGAATACCCCTCGGTCCTTTCCGACAGACTGAAAATACTAGACAGGGACAGAATCAATAACTACCAGAGGCGTATCGATTTCGACACCTCGAACTTGACGGCGCGCGATCCGGGACCCTCGTCGGCATTTTACGCCGACAACGCGTACCGGTCCAACGTTCAGGAACGGATGGAGACGCTCTCGGAACAGCTGACGAAGGTTTTGAGCACCGGGGCCGGGAGCTCACACATAAATGGTAGCTTAGCCGACAGCGGCATACAGACGGACAACACCAGCACCAGCGTGCCCCAGATATACGTATCGGAGGCGAACGTCGGACCACCGTTGAAGGAGCTCAGAGACGCGGCCGTCGATACCCGAAACGAGAACAATCTCCAGGACATACCGTTCATAGACGACGACGACGACGTCCGGTGGAAACGCAGGGCCAACATTGAGAAGCACAAGAGCATGTCCAACATACCGGAACGCGTCGAGGAGACAGCTAAGGAGCTCGCCGAAGAACGCCTCACGAACAGCCTCAATCGAGCGAAATCGCCAACGTTCGTCGAGAAATTCAAGAAATTCTTCGCCGATATAGGCCTCGTCAAACCAGAGGTCGAGAACACGGAAAGAGACGCCAACACTCTACCGAAGAGCCTCAATTCCAGTTACAGAACGAGAAGCGCGACCCCAACTTCGCTGGAGACCCGCGAAACGTCCACGCTGCCCAAGGATATGAGGTTCCGTAAGGTCAGGTCCACGCAGACGGTGTACATAAGGCAAGAGTCGCCGCTGCTGAGAGACAGGGAGGTCCAGACTCCGCCGCAGACTAAAGAGCAACACGTCTCCGTGGTGCAACTCAACGGAGACGAGCACGTAAAGTGTGAGGACTCTGAGAAGTTTCTAAAAGAAATCGTCTACATCAAGAGTATCGATAAAGCCGAGATATACACCGGCAAGGATAGCGGTAGTACAATTATCGTAATACCGCCTGCAGACTGA
Protein
MHQKYDLKGSTYKRKASKTERQKTSPTYKDLDFMEHHNEGIFLEADTYTALIKTMQRDCRVLESFKIMDYSLLVGIHNLDDAQREKNEARKLTESGQSDGEDNEGETKRTGLNRTRSEAREDFGIQVKRTQSINRQRLVAHSTAMESIQAESEPIDEEEDVPSGGIPARNARGERLLLFLGIIDILQSYRLRKKLEHTWKSMIHDGDTVSVHRPSFYAQRFLDFMAKTVFKKIPSLDLPEIKGNHRKFRTLVTSYIALKHSPSKRKSIAKPSRPQEEIDTPGRFIGRPIKDYNPEYLRQARLSPRSSVRSSMSDFTDTTISTWNQRHPPAPAEYPSVLSDRLKILDRDRINNYQRRIDFDTSNLTARDPGPSSAFYADNAYRSNVQERMETLSEQLTKVLSTGAGSSHINGSLADSGIQTDNTSTSVPQIYVSEANVGPPLKELRDAAVDTRNENNLQDIPFIDDDDDVRWKRRANIEKHKSMSNIPERVEETAKELAEERLTNSLNRAKSPTFVEKFKKFFADIGLVKPEVENTERDANTLPKSLNSSYRTRSATPTSLETRETSTLPKDMRFRKVRSTQTVYIRQESPLLRDREVQTPPQTKEQHVSVVQLNGDEHVKCEDSEKFLKEIVYIKSIDKAEIYTGKDSGSTIIVIPPAD

Summary

Pfam
PF01504   PIP5K
Interpro
IPR023610   PInositol-4-P-5-kinase        + More
IPR027483   PInositol-4-P-5-kinase_C       
IPR027484   PInositol-4-P-5-kinase_N       
IPR002498   PInositol-4-P-5-kinase_core       
Gene 3D
PDB
5E3U     E-value=1.66804e-59,     Score=583

Ontologies

Topology

Length:
659
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0085
Exp number, first 60 AAs:
4e-05
Total prob of N-in:
0.00107
outside
1  -  659
 
 

Population Genetic Test Statistics

Pi
5.725649
Theta
165.474723
Tajima's D
-1.165562
CLR
257.317182
CSRT
0.106744662766862
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号