SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00866
Pre Gene Modal
BGIBMGA007097
Annotation
retroelement_polyprotein_[Glyptapanteles_flavicoxis]
Location in the cell
Nuclear   Reliability : 3.337
 

Sequence

CDS
ATGACACTCATTGTAATCAATGCTGACGTCACACTTTTTAAAAACAATACGGAGGTTAATGTTCCGTCATCAGAAGTGGGATCACATGCTGCCTCCGCTCAGCAACAACCTGAAGCTACATCACAAATAGAACCACACCATGGATTAAATACTACAGGCAATGCTGGGAGTTCCTTGGAACAGGAACAGGAACAGCCACAATCAGCATTGCTTAACGCACCGATGAGCAGCGTACCGCCACAATTCATCATGCAGATGATGCATGTGATGCAGCAAATGTCGGAACGCTTAAGTACACCAGCAGAAACTAAGATACGTATAAATGATATTTACCTACCATCATTTGACCCCGATACTAGTGTGGGAGTACGTGAGTGGTGTCAACATATCGACAAAGCCATTGAGACTTATCGACTCAACGACTTTGACATACGCATGAAAGTTGGCAGCCTCCTAAAGGGAAGAGCGAAGATGTGGGTTGACGATTGGATGGTCACTGCAGCTTCGTGGGCTGAGCTGCGCAACAATCTTATCACGACATTCGAGCCAGAAAATCGCTATTCTCGAGACATAGCTCGATTTAGAGAACATATGTACGACTCTTCAAAGGACATCTCGGAGTTCTTGTCACGAGCTTGGGTCTTGTGGAGGAGGATCACCAAAGACAAACTACCTAATGAAGATGCAGTTGAAGCAGTTATTGGTTGCGTGAATGACGAGAAACTTAGGATCGAGCTACTGAACACAAGAGCCACAACAGTACCAGAATTGATATCTGTTGCATCATCAGTAAGAGCCATGAAGCGTTTTCACCAGGGCTCAAATAAGCTGAGTACAAATAAGCGTCCCCGTTTTTTGAATTCTACTTCATCAAATTCATCTTGCCATATCTGTAAAAGAACTAATCACACCACCAACGAATGCTACTACAAAATGGTTACCGAATCAAAGCCCGAACAAAGAAACAAAACAACAACTGAGACAACGAAGGAAGTAACCTCCTACCAGAACGATAAAACAACAATCTGTTCATTCTGCAAAATACCAGGACACAGTTTTGAAACATGCTTCAAACGTGAACGAGCATTGACATCAAACGTAAATTACGTTGCTGGATCAAAACTAGCTCCGATTCAGGTGAAGTTTGGATCAAAGAGTTTTCAGGCAATCTTTGATAGTGGCGCAGAATGCTCACTTATGCGGGAATCCGTAGCAGCTCAAATACCCAGAAAAAGACTACAAACGGCAGATTACTTGAAAGGAATTGGACAATTTCCTGTACTATCAATAGCTACACTCGTAACGGTAGGTGTCATCGATAACATCAACGTTGAATTACAGTTTCACATAGTGGCAGATTACGAGATGACTACAGATATTTTAGTGGGTATGAACTTGATAAACAATACGAACCTAACTATGACGATCACTTCGGGCGGGACGAGGCTAGCACGTCAGCCACATGTTAATCAAGTTCAGTGTATAAATCCAATTTTCGATAAACTGGATTGTGATCTCACAAATGAAGAAGATATCGCAAAATTACGCACCCTTCTAAACAAATATCAGCACCTGTTTATCAGAGGGTATCCAACAACTCGTGTCAAGACAGGTGAACTGGAAATCCGCCTGAAGAATCCAAACAAATATGTAGAACGAAGACCTTACAGGCTCAGTCCAATCGAACGAGAAAGGGTGCGAGCCATTGTGAAAGAGTTGATGGAGCATGGCATTGTACGCGAAAGCAAGTCTCCATACTCCAGTCCCATCATCTTGGTGAAGAAGAAGAATGTCTATCAACGATGCATCAACAGAGCTCTGAGCTCGTTAATAGGGAATGCAGCTCAAGTCTACGTCGATGACGTATTAAGCAGATGTGAAAATATCGCAGAAGGGCTGTCAAACATAGAACGTATTCTAATAGCACTACAAGATGCGGGTTTTTCCATTAATGCTGATAAATGCAGTTTTTTTAAGCGCTCAATCGAATATTTGGGTAACGTAGTATCTAATGGACAAGTCTGGCCAAGCCCACGGAAAATAGATGCTCTGGTAAAATCGCCGGTACCAACAACACCCAGACAAGTAAGACAATTTTGTGGATTGGCTGGCTACTTTAGAAAATTTATAGCAGACTTCTCACGCATAATGATACCACTATACGAGTTGACCAAATCAGGGGCTAAATGGGAGTGGGACGAGCGCCATGAGAAAGCAAGAGAGAATGTCATTCAGTGCTTAACATCAACTCCAGTACTTACACTATTCCAGGAGGAAGCACCTATTCAATTGTACACAGATGCAAGTAGTTTGGGATTCGGAGCAGTACTGGTACAAGTAATTGCGGGACGACAACATGCAGTTGCCTTTATGAGCATGAGAACTACTGAAACAGAAAGTCGCTATCACTCTTATGAATTAGAGACCTTGGCAGTAGTCCGAGCGATAAAACACTTTCGGCAGTATCTTTATGGACGTAAGTTTACAGTTATCACAGACTGTAATGCACTAAAAGCATCCAAACACAAAAAGGACTTACTCCCTAGAATCCACCGTTGGTGGGCATTTTTACAAAATTATAATTTTGAGGTTGAATACCGCAAGGGTCAACAGCTTCAACACGCAGACTACTTCAGTAGGAACCCAGTCGAACTCACAGTGAATATAATGACCAGAGATCTAGACTGGCTGAAAATTGAACAGCGACGTGATGAAACACTACGAGCTATAATGGATGGTATGAATAATAACAATCCAAGTAACGGCTATATGCTAGAAAACAATGTCCTCAAGCATATCGTACAAGATCCAACCTTCGGACACCGATACTGCACAGTGGTACCCAGGTCCTTTCAGTGGAGTTTAATAAACTCCTTCCACACCGCACTGAAGCACCCTGGCTGGGAAAAGACGTTGCAGAAAATTAAGGACAGCCACTGGTTTGACAACATGAGCACGAAGGTACGAAAATTTGTTGATAATTGCGTGGTCTGCAGGACATCGAAAGGAGCATCTGGTGCGGTACAAGCTCAAATGCACCCGATTCAGAAACCGTCTGCTGCTTTTCAAGTAATACACATGGATATAACAGGCAAGATGGGAACATCCAACGACCAACAGTATGTGATTATCACCATAGATGCTTTTACGAAATACGTGCTATTCTATTATGCAACTAACAAAAATCCACCCAGCACATTAGCTGCCTTAAAGCGTACGGTTCATCTATTCGGTACTCCTGTCCAAATAATAGTCGACGGTGGAAGAGAGTTCCTCGGTGAATTCAAGACCTACTGCGATAGGGTAGGTATTGACATTCATGCTATAGCACCAGGAGTCAGCCGAGCAAATGGACAAGTAGAACGCGTCGTAGCTACACTAAAAAATGCTCTTACTATGATCAAGAATTACGAAACAGAAGAGTGGCACACAACGATTGCAGAACTTCAGCTAGCAATAAATTGCACTCCGCATCGTGTGACAGGCGTAGCTCCACTTACATTACTCACTCAGCGAAAGCATTGTGTTCCTCCAGAGCTACTTAAATTAGTAAATATTGACGAGCAGACTATTGATATTGAAGCACTCACTAACCATGTTCAACACAAGATGTCACAAAATGCAGAACAGGACAGGCAACGTTTCAATTCAAAAAAAGCTAGGATCCATCATTTCCAGCGTGGTGATTATGTGCTCATAAAAAATAATCCTCGTAATCAAACTTCGTTGGATCTCAAATTCAGCGAGCCATATGAGATAACAAGAATCCTGGACAACGACCGCTATTTAGTAAAAAAGGTGGTTGGTTCAGGGCGTTCAAGAAAAGTAGCTCATCATCAACTCCGTCGGGCACCGCAACCTGGAGACCAGATAGCCGTATCGGCGGAAGAAGACGACCCTCCAGCATCAGCCGATGAACCTATATGA
Protein
MTLIVINADVTLFKNNTEVNVPSSEVGSHAASAQQQPEATSQIEPHHGLNTTGNAGSSLEQEQEQPQSALLNAPMSSVPPQFIMQMMHVMQQMSERLSTPAETKIRINDIYLPSFDPDTSVGVREWCQHIDKAIETYRLNDFDIRMKVGSLLKGRAKMWVDDWMVTAASWAELRNNLITTFEPENRYSRDIARFREHMYDSSKDISEFLSRAWVLWRRITKDKLPNEDAVEAVIGCVNDEKLRIELLNTRATTVPELISVASSVRAMKRFHQGSNKLSTNKRPRFLNSTSSNSSCHICKRTNHTTNECYYKMVTESKPEQRNKTTTETTKEVTSYQNDKTTICSFCKIPGHSFETCFKRERALTSNVNYVAGSKLAPIQVKFGSKSFQAIFDSGAECSLMRESVAAQIPRKRLQTADYLKGIGQFPVLSIATLVTVGVIDNINVELQFHIVADYEMTTDILVGMNLINNTNLTMTITSGGTRLARQPHVNQVQCINPIFDKLDCDLTNEEDIAKLRTLLNKYQHLFIRGYPTTRVKTGELEIRLKNPNKYVERRPYRLSPIERERVRAIVKELMEHGIVRESKSPYSSPIILVKKKNVYQRCINRALSSLIGNAAQVYVDDVLSRCENIAEGLSNIERILIALQDAGFSINADKCSFFKRSIEYLGNVVSNGQVWPSPRKIDALVKSPVPTTPRQVRQFCGLAGYFRKFIADFSRIMIPLYELTKSGAKWEWDERHEKARENVIQCLTSTPVLTLFQEEAPIQLYTDASSLGFGAVLVQVIAGRQHAVAFMSMRTTETESRYHSYELETLAVVRAIKHFRQYLYGRKFTVITDCNALKASKHKKDLLPRIHRWWAFLQNYNFEVEYRKGQQLQHADYFSRNPVELTVNIMTRDLDWLKIEQRRDETLRAIMDGMNNNNPSNGYMLENNVLKHIVQDPTFGHRYCTVVPRSFQWSLINSFHTALKHPGWEKTLQKIKDSHWFDNMSTKVRKFVDNCVVCRTSKGASGAVQAQMHPIQKPSAAFQVIHMDITGKMGTSNDQQYVIITIDAFTKYVLFYYATNKNPPSTLAALKRTVHLFGTPVQIIVDGGREFLGEFKTYCDRVGIDIHAIAPGVSRANGQVERVVATLKNALTMIKNYETEEWHTTIAELQLAINCTPHRVTGVAPLTLLTQRKHCVPPELLKLVNIDEQTIDIEALTNHVQHKMSQNAEQDRQRFNSKKARIHHFQRGDYVLIKNNPRNQTSLDLKFSEPYEITRILDNDRYLVKKVVGSGRSRKVAHHQLRRAPQPGDQIAVSAEEDDPPASADEPI

Summary

Uniprot
Pfam
PF00078   RVT_1        + More
PF00077   RVP
PF00665   rve
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR018061   Retropepsins       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF50630   SSF50630        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal
PDB
4OL8     E-value=2.84686e-32,     Score=351

Ontologies

Topology

Length:
1308
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0510000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00132
outside
1  -  1308
 
 

Population Genetic Test Statistics

Pi
399.864126
Theta
217.308157
Tajima's D
0.441743
CLR
31.648198
CSRT
0.499625018749063
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号