SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00864
Annotation
PREDICTED:_uncharacterized_protein_LOC106709922_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.925
 

Sequence

CDS
ATGACGAATGAACAAATGGAATTATTATTCTCAAAATTCGATGCAAAGTTAGATGAAAAGCTTAATCAACAAACCCAAACATTAACAACAGCAGTTACTAAGAACGTTATGGAAGCAATGGATGAAAAGATGAAAATATTAATGGAAGAAAACCAAGAATTAAAATCTGAAGTATCAAGACTAAAACGCAAAATCAATACCTTGGAAAAAGAAAAGCGAAAAAGCAACCTGATTTTCTTTGGTGTTGATGAAAATGGGAAAAGAGAGACAGAACTAGTTGACTACATAAAAGGAATTATAGAAGAAGCGAAAGTGCATATAGACAGCCATGAAATAAACAACATCTATAGAATTGGAGCGCAAACCAGCGAAAATCGCCCTGTAGTGGTTACTTTCTCTACTATGTGGAAGAAACATCTTATATTAAAATCTAAATCAAACTTACCAACAGGCATTTATGTCAAAGAGGACTTCCCCAAGGATGTCCTTGAAGCCCGGAAAAAACTGCAGCCAAAAGTGGAGGAAGAATGGAAAAAGGGGAACATAGCTTTCATGAGAGGAGACCAACTCGTAATTAAAAAGCAGAAGGACAACCAGCGCGAAAAGAGGAAGAGAGACAAGACTATATCCCCCGAATTTCAAACAATGAAAAAACCGAATACTCATAATGGAACTGGAAACAAAACAAATAAAGCTAAAACTATTGGACAAAAAGAAATATTGAAACCAAACATTTTACAATACATGGGAAGAGATAGAACTACTTCCACTTCAACTTCAGGAAATTCAAAAAACTAA
Protein
MTNEQMELLFSKFDAKLDEKLNQQTQTLTTAVTKNVMEAMDEKMKILMEENQELKSEVSRLKRKINTLEKEKRKSNLIFFGVDENGKRETELVDYIKGIIEEAKVHIDSHEINNIYRIGAQTSENRPVVVTFSTMWKKHLILKSKSNLPTGIYVKEDFPKDVLEARKKLQPKVEEEWKKGNIAFMRGDQLVIKKQKDNQREKRKRDKTISPEFQTMKKPNTHNGTGNKTNKAKTIGQKEILKPNILQYMGRDRTTSTSTSGNSKN

Summary

EMBL
NWSH01001771    PCG70189.1    ODYU01000586    SOQ35631.1    ODYU01000585    SOQ35630.1    + More
NWSH01002532    PCG68054.1    FJ265564    ADI61832.1    NWSH01005231    PCG64345.1    NWSH01003397    PCG66369.1    NWSH01004020    PCG65566.1    NWSH01000260    PCG77926.1    BABH01021795    NWSH01003169    PCG66835.1    JTDY01000511    KOB76839.1    JTDY01003098    KOB70157.1    NWSH01001196    PCG72157.1    JTDY01002536    KOB71226.1    JTDY01000743    KOB76037.1    JTDY01001071    KOB74965.1    ODYU01001637    SOQ38140.1    GDQN01002055    GDQN01002009    JAT88999.1    JAT89045.1    NWSH01000023    PCG80652.1    JTDY01014369    KOB52037.1    KQ459995    KPJ18566.1    GBGD01002698    JAC86191.1    ODYU01008249    SOQ51673.1    JTDY01000640    KOB76373.1    JTDY01002701    KOB70892.1    BABH01035234    BABH01035235    FJ265563    ADI61831.1    NWSH01002039    PCG69337.1    JTDY01009161    KOB64038.1    JTDY01007191    KOB65392.1    JTDY01000408    KOB77334.1    JTDY01000780    JTDY01000104    JTDY01000008    KOB75906.1    KOB78842.1    KOB79479.1    ODYU01010663    SOQ55918.1    JTDY01009971    KOB62006.1    JTDY01000843    KOB75692.1    JTDY01000437    KOB77173.1    JTDY01000895    KOB75518.1    GEZM01039814    JAV81166.1    ACPB03027049   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR004244   Transposase_22       
IPR027124   Swc5/CFDP2       
IPR001680   WD40_repeat       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR011990   TPR-like_helical_dom_sf       
IPR036322   WD40_repeat_dom_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF50978   SSF50978       
Gene 3D

Ontologies

Topology

Length:
265
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01616
outside
1  -  265
 
 

Population Genetic Test Statistics

Pi
395.887325
Theta
208.642494
Tajima's D
2.645042
CLR
0
CSRT
0.956602169891505
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号