SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00858
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Guanylate cyclase      
Location in the cell
Nuclear   Reliability : 2.982
 

Sequence

CDS
ATGGAAAAACAAACAACAACCCTAACAGATTCAATCACAAAAGCGGTATTAAAAGAAATGGATGATAAGTTAACACCAATTATAGAGGAAAATTTGTTTCTAAAGAATGAAGTAGAGAAATTAAATGAGAAAGTGAAACGCTTAGAATTTGGAAAAAAGGAGAATAATTTAATATTCTACGGCTTCGAGGAATCGAATGAAAATATTAACATAGTAGAAATGGTATCAACAACTTTAAACGATTCGGGTATCGAAGTGCATAAAACACATATTAACAAAGCGTTTAGAATTGGTAAAATAAAAGAAAGAGCACGCCCAATTTTAATTAATATGCTAAACGCATGGAAGAAAGATGAGATTTTGCGAAATAAGAAAAAGCTGCCAAAAAATATTTACGTTAAAGAGGATTATAGTAAAGAAGTTTTAGAAAGAAGGAAAGAACTAATACCTCAGTTAAGGGAAGAACGAAAAAAGGGACGTATAGCATACATAAAATACGACAGACTAATTGTTGAAGGCCTCGCAGAAATCCGAAAAATGGGATGTAAAATCGAAGAGTACAGCGACCTTATCTTTTGCTACATTGGCGAAACTAAAGGACTACATGGAGTAGGATTTTTAATCAAGAAAAAATATAAAAACAACATCACCAACTTTATAGGAATCTCAGAAAGAGTAGCACTTTTGCAAATAAAATTTGAAAGCCTCTCCTTATCAATAATCCAAGCATACTCGCCGACAGAGAGATCAACAGAAGAAGAAATTGAAAAATTTTACGAAGATATTGAATATGCTCACACCAAGACGGAAGGAAAGGTCATAGTCATGGGAGATTTCAATGCGAAAATAGGTTGCCCGAAAACAAACTACTATCCAGTAATGGGAAAATATGGTTACGGAGTGAGTAATGAAAGAGGTGAACGTCTCTTAAGTTATGCTTACCAACACAAACTGTCAATAATGAACTCATTCTTCAAAAAGAAGAAGTGCCGCAGATGGACATGGTTATCACCGGACCAAAAAACTAATAATGAAATAGATTTTATAATGATAAATCACCATAAACTCATAACTAATATCGAGGTACTAAGCAAATTTAACTTTTCTTCCGATCATAGATTAGTGAGAGCATCATTACTTTTAAGTCGTCCAGTAAAGAGCAGAAGAAGCTACACAACACCATTTAATGTCCCTAAGACAGAAACAGAAATTAAAAACTATATCGAAAATCTACGAATACACACAGAAAATATAGAAACAGAGTGTAATGATATCCAAACATACTACGATATCCTAGAAAGAGGCATAACAGAGAGTCTAAAATACAAAAACAGTGCACATGCTCATCAACACAATATTTTCTCCAAAGATACAATCCAGCTTATAAAAAGGCGCACGGAACTATCATACACAAAGAATAAAACTAAAGACATGAAAGAAGAACTCAGCAGAATATACAAAGAGGCTAATAGGTCAATCCGTAAGGACTACAACGACCACAGATATGAGATTATCTCAAGAAACATACAGAATTTTAGAAGTACCAAAAAAGCCTACAAAGAATTAACTACACATAAGTCATGGATTCAAAAACTCGAACATAACTCACTAGAAACAAAATCTAGAAAAGATGTAATAAACCATGCGACAGACTTCTATAAAAACTTATATAAGAAACAAAACAGCATTGAAACGAAAGCGCAAATAACTCACATGAACACAACAGACTGCATCAGAAAAATTCAAGACTCCGAAGTGTACGAACAAATGAATAAGTTGAAGCCTGAGAAGAGTCCCGGACCAGATGGACTATGTAATGAGGCCCTTAAAATAGCAGCACCTATTTTAACACGCCATTTTACGAAATTGTTTAACATGATACTAGACGAAGAAAAAGTACCGAAACAATGGTGTGCATCAGACATAATTTTACTCTTCAAGAAAGGATGTCCCTTAGATATAGGAAATTATAGACCCATAAGCCTGCTGGCGAGCATATATAAACTATTTTCATCCATAATTTTAAAGAGAATATCCGACGACATCGACAAGCTGCAACCAAAGGAGCAGGCGGGATTCAGATCAGGCTTTAGCACAATGGACCACATACAAACACTAGAGCAGGTCATAGAAAAATACAGAGAATATAAAAGACCTCTGTATGTGGCCTTCATTGACTACAGTAAAGCTTTCGACAGCATCAGTCACTGTTCAATCTGGAACGCATTACAACAATCAAATGTTAACTATAAATACATCAATATCTTGAAATATATCTACACAAAAAGTACGAGCAGAGTTAAATTAGAAACTAGAGGAGACGAGATAAAAATAGAACGAGGAGTCAGACAGGGAGATCCTCTTTCCCCGAAGCTGTTCATAGCAGTACTTGAAACTATTTTTCAAAAACTAGATTGGAAAAAAAGGGGAGTGTACATAAACGGACACTACCTAAACCATCTGAGGTTCGCTGACGATGTTGTTATAATTGCTGAAACTGCCAAAGACCTAGAGGAAATGATGAGATCACTGGACTGCGAAAGTTCAAAAATCGGCCTAGAAATGAATGTAAGCAAAACTAAGATATTAACCAACAATCACGAACGCCCGATAATGATAAAAGGTAACAATATAGAATACGTCAGCGAATACATCTACTTAGGGAAGCAAATCTCATTCAAAACGACAAGCAACGAAGAAGAAGTAACAAGAAGAATCAACGCAACTTGGAAGAAATTCTGGGCACTAAAAGAAATCCTAAAAGGGAACTACAGCTTGCGTATGAAAAGGGCAACATTTGATACATGCCTGTTACCCTGCTTGTTGTATGGCTGCCAAACGTGGATATTTACAAATAAAATAAAACAAAAAATTAAATGCAGTCAAACAGCCATGGAAAGGAGCATGTTGAAAATTAGAAGAATACATAGAATTAAGAATGAAAGCATTCGTCAAAAAACTAAACTTACCGATGCTCTCAGCCACGCACTCTCACTTAAGTGGAGATGGGCCGGACACATCTCACGATACCCAGACAAAAGATGGACCATTGAAGCCACACGATGGAAAGGACCAATGGGGAAAAGGAATGTTGGTCGACAATTAAGACGATGGGCCGATGACATAACACACGTCGCAGGAAACGACTGGATAAAATCAGGCAAGGACAAGGAGTCATGGAAAAGGATGGAGGAGGCCTTTACCCAGATAGGGGTCCAAATCTCATAA
Protein
MEKQTTTLTDSITKAVLKEMDDKLTPIIEENLFLKNEVEKLNEKVKRLEFGKKENNLIFYGFEESNENINIVEMVSTTLNDSGIEVHKTHINKAFRIGKIKERARPILINMLNAWKKDEILRNKKKLPKNIYVKEDYSKEVLERRKELIPQLREERKKGRIAYIKYDRLIVEGLAEIRKMGCKIEEYSDLIFCYIGETKGLHGVGFLIKKKYKNNITNFIGISERVALLQIKFESLSLSIIQAYSPTERSTEEEIEKFYEDIEYAHTKTEGKVIVMGDFNAKIGCPKTNYYPVMGKYGYGVSNERGERLLSYAYQHKLSIMNSFFKKKKCRRWTWLSPDQKTNNEIDFIMINHHKLITNIEVLSKFNFSSDHRLVRASLLLSRPVKSRRSYTTPFNVPKTETEIKNYIENLRIHTENIETECNDIQTYYDILERGITESLKYKNSAHAHQHNIFSKDTIQLIKRRTELSYTKNKTKDMKEELSRIYKEANRSIRKDYNDHRYEIISRNIQNFRSTKKAYKELTTHKSWIQKLEHNSLETKSRKDVINHATDFYKNLYKKQNSIETKAQITHMNTTDCIRKIQDSEVYEQMNKLKPEKSPGPDGLCNEALKIAAPILTRHFTKLFNMILDEEKVPKQWCASDIILLFKKGCPLDIGNYRPISLLASIYKLFSSIILKRISDDIDKLQPKEQAGFRSGFSTMDHIQTLEQVIEKYREYKRPLYVAFIDYSKAFDSISHCSIWNALQQSNVNYKYINILKYIYTKSTSRVKLETRGDEIKIERGVRQGDPLSPKLFIAVLETIFQKLDWKKRGVYINGHYLNHLRFADDVVIIAETAKDLEEMMRSLDCESSKIGLEMNVSKTKILTNNHERPIMIKGNNIEYVSEYIYLGKQISFKTTSNEEEVTRRINATWKKFWALKEILKGNYSLRMKRATFDTCLLPCLLYGCQTWIFTNKIKQKIKCSQTAMERSMLKIRRIHRIKNESIRQKTKLTDALSHALSLKWRWAGHISRYPDKRWTIEATRWKGPMGKRNVGRQLRRWADDITHVAGNDWIKSGKDKESWKRMEEAFTQIGVQIS

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
EC Number
4.6.1.2
EMBL
FJ265562    ADI61830.1    FJ265563    ADI61831.1    ODYU01008249    SOQ51673.1    + More
FJ265564    ADI61832.1    FJ265561    ADI61829.1    ODYU01004088    SOQ43598.1    GBBI01004876    JAC13836.1    KZ149907    PZC78256.1    GBGD01000380    JAC88509.1    FJ265542    ADI61810.1    FJ265550    ADI61818.1    FJ265549    ADI61817.1    FJ265551    ADI61819.1    FJ265545    ADI61813.1    FJ265544    ADI61812.1    FJ265543    ADI61811.1    JARK01001655    EYB84321.1    JARK01000173    EYC41342.1    JARK01000388    EYC37469.1    JARK01001370    EYC16150.1    GL379822    EGT48339.1    JARK01001568    EYB89432.1    QFQQ01000179    PZR20596.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    EYC16376.1    JARK01001353    EYC22263.1    JARK01001473    EYB97806.1    JARK01001389    EYC11015.1    JARK01001639    EYB85201.1    JARK01001565    EYB89683.1    GBBI01004877    JAC13835.1    JARK01001348    EYC25050.1    EYC25048.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001438    EYC02111.1    JARK01001337    EYC34625.1    EYC25046.1    EYC25049.1    JARK01001354    EYC21986.1    GDKW01001596    JAI54999.1    JARK01001424    EYC04316.1    EYC25145.1    EYC04317.1    EYC04314.1    JARK01001470    JARK01000204    EYB98081.1    EYC40601.1    EYC04315.1    JARK01001475    EYB97550.1    JARK01000302    EYC38674.1    JARK01000248    EYC39628.1    JARK01001711    EYB81734.1    JARK01000077    EYC43894.1    JARK01001338    EYC33297.1    EYC10874.1    JARK01001344    EYC28216.1    JARK01001372    EYC15614.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    JARK01001421    EYC04912.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    EYB98082.1    EYC40602.1    JARK01000063    EYC44387.1    JARK01001497    EYB95322.1    JARK01001581    EYB88505.1    JARK01001502    EYB94855.1    JARK01001531    EYB92324.1    JARK01001346    EYC26445.1    JARK01001340    EYC30744.1    JARK01001380    EYC13322.1    JARK01000109    EYC42952.1    EYC03125.1    JARK01000008    EYC46079.1    JARK01001401    EYC08686.1    JARK01001357    EYC20551.1    JARK01001612    EYB86585.1    JARK01000165    EYC41537.1    JARK01001543    EYB91356.1    JARK01001637    EYB85284.1    EYB95049.1    JARK01000161    EYC41641.1    JARK01001730    EYB81048.1    JARK01001618    EYB86258.1    JARK01001365    EYC18010.1    JARK01001407    EYC07212.1    EYC18009.1    EYB85282.1    JARK01001582    EYB88498.1    JARK01000146    EYC42042.1    JARK01000177    EYC41209.1    EYC41210.1    EYB85285.1    JARK01001524    EYB92970.1    JARK01000460    EYC36749.1    EYC30828.1    GBGD01000453    JAC88436.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF00211   Guanylate_cyc
PF07714   Pkinase_Tyr
PF01094   ANF_receptor
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR029052   Metallo-depent_PP-like       
IPR001828   ANF_lig-bd_rcpt       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR001170   ANPR/GUC       
IPR011009   Kinase-like_dom_sf       
IPR028082   Peripla_BP_I       
IPR001054   A/G_cyclase       
IPR000719   Prot_kinase_dom       
IPR029787   Nucleotide_cyclase       
SUPFAM
SSF56219   SSF56219        + More
SSF56112   SSF56112       
SSF53822   SSF53822       
SSF55073   SSF55073       
Gene 3D
PDB
6AR3     E-value=0.00322313,     Score=100

Ontologies

Topology

Length:
1075
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.52588
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00059
outside
1  -  1075
 
 

Population Genetic Test Statistics

Pi
48.819658
Theta
47.970126
Tajima's D
0.165665
CLR
0.035524
CSRT
0.422528873556322
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号