SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00835
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.341
 

Sequence

CDS
ATGTCAGAGGATATGACAAAACTATTCCAGATGATGAAATTGGAACTCGATAAACAAACTGCAACGATTACTCAGAGTGTAACCGACAGTATCATGCGCAATATAGACGACAAAATAAAACCAATATTGGAAGAAAATAAGTATCTTAAAAACGAGGTACAGAAGTTGAATGATAAAGCAAGATACTTAGAAAACAAAGACACCGGTAACGAAATCGCAACTAGAATAGAAAAACCATCCAATACATATAATGAAAACCCCAATACGGCTGGTCACCGCGGGGTTACCGATCACTACCCCCAAGATCTCGAAAATTTCGACTCTAATCCAAATCCAACTAAAAACCAGACGTTAAATGAAGCAAATACAAAGGCTAGAAAACATAGAATATATATAGCAACACTAAATACTAGATCATTAAAATCGAAGGAAAAATTATTAGAACTGGAACAGGCTTTGAATCACATAAATTGGGATATCCTCGGCATAAGTGATGTCAGACGGTCGGCTGAAAAAATTGAAGAACATGATGAATACATATTATATTACAAAAATGAACAACCAGGAATATATGGCGTGGGATTCTTGGTTAAGAAATATCTTAAAAACAATATAATAGAGTTTAAAGGAGTGTCAAATAGAATAGCAATTTTAAATATCACTCTTCCTGGCTACAAAAATCCGACTTCAATTGTTCAGATATACGCTCCTACAGAAACAGCAAAGAAAGAGACTAAAAACGAATTCTACAAAAGCTTAAATGAAATAATGGAGAATTTATACAAAACCATTATTGTAATGGGAGATTTTAATAGCCAAATTGGTCAGAGGAGAAAAAACGAAGATAAAATAATAGGACCCTACACAATAGGCAAACGAAATGACAACGGACAAAGGTTGATAAACTACGCGGCAGAGAATAACTTAACTGTAATGAATAGTTTCTATAAAAGAAATCTTCTAAGAAAATGGACATGGCAATCTCCTGATGGCATAACAAGAAACGAAATGGACTTTATTACAACAAATAAACCGAAACTTTTCTTAAACGTGGAAGTTCTCAACAGATTTAATTTTAACACAGATCACAGATTACTACGAGGCCACCTTCATATGTTTCAACCAAAAAACCAAAGAAAATTTATAAAAAATAGAAAGCTGCCAATCATACTACCAGTACCAAATTATATATTAAAATCTTTAGAAATAAAGCTACGACCAATTAAAGAACTGAAAACGACACAAGAAAAATATAATACTCTGGAAAACGTATTAAAAGAAATCAACAAACAGCTAGAAAGAGAAAACACACCAAAAGATAGATTAGGACCAATAGCAAGGGAACTAATAAGAAAGAGGAGCCTTCTATTTAGTAATAGAAAGAACAACAAGCAAGAGATAACAAAAATTAGTAAAAATATAAACTTAGAAATACGAAAGCACAAACAAAAATTAAGAACAGAGACATTACAACTTCATATAGATAAATCAGGTGGGCTCAAGAAGGCATGGAAAGAACTCCAAGAATATACAACTTGGATAAATAACGTAACACACCACAAGACAAAAAAACATAAATCGGAAAGAAGTGACATACTCCAAACCGCGACCGATTTCTATCGAGAGCTCTACGATGACCAATCAATAACACCTACTTTAAGCAAAGAAGAAGAAAAAAATTCAGAAGAACAGGTGCCTAGCATACTAATAGATGAAGTCAATAATGCCACGAAGTCACTAAAGAAAAATAAAGCACCAGGGGAAGACAATATTTCTAATGAACTTCTTGTCGGAATGTACCATGCTATCTCCAATACACTAACCGACCTATTTAACGATATTCTAACAACGGAACATATACCTCAACAATGGACTACATCAACGATTATCTTAATTCATAAGAAAGGCAGAACAGATGATATTTCGAACTATAGACCCATTTCACTAATGTCTAATATTTATAAACTTTTCTCCAAGATAGTTCTAGAACGATTAACAAGGACTCTGAACGAAAATCAGCCAAAAGAACAGGCAGGGTTTAGAAGTGGCTTCTCTACTCTCGACCATATACATACTATAAAACAAATAATCCAAAAATGTAATGAATATAACATCAACTATTATTTATCGTTTATAGATTATAACAAAGCATTTGACTCGCTAAAACATCAGAAAATATGGGAAGCGCTTGCTTTACAAGGAGTCCATAATAAGTACATCCGTCTATTGAAAAACATATACGAAAACATGAAAGCAAGAGTACGGACAGAAAAGCTAGGAGAACACTTTCACATCAAAAAAGGAGTTAGACAGGGAGACCCCCTTTCACCCAAACTTTTCTCTGCAACCCTAGAACATGTGTTTCGTCAGCTCGAATGGGACGATTACGGTATTAATATTAATGGAGTGTTACTAAATCATCTGAGATTTGCCGACGACCTCATACTTATAAGCGAAAATCCAGAAACTTTACAAAAAATGATTGAGCAACTTGTACGTGAAAGTGAAAAAGTTGGACTATCATTGAACACAAACAAAACAAAGCTGATGACAAATTACAAAAAAGTCCCTATCAAACCTTACAACACAGCTAAATTAGAATATGTAAATGAGTATACATACCTCGGCCAAATCATATCCCCCAAAGACCTCACAGCAAAAGAAATCAGTAACAGAATAAATATAGGATGGAAAAGGTACTGGGCATTAAAAGATGTTATGAAGAATTCAGAAATACCTGTTAAGGCAAAGAAGAAAATATTTAATACATGCATTCTTCCAAGTATGACCTATGGATGCCAAACATGGGGATTGACAAATAAGAACATAAAATCTTTAGAAATTTGTCAACACCGAATGGAAAGAAGTATGTTAAACATGAAATTAAAAGATAAAATACGGTTAACAAAAATAAGAAAACAAACAAAGATCATAGATATAAAATACCGAATACAACAACTGAAATGGAAATGGGCTGGACATTTAATTCGAGATAAAACAGAAAAATGGGCCAAAGGAGTGACAGAATGGTGTCCTAGATATAAAAAGCGAAATAGAGGAAGACAGCAACGTAGATGGGAAGATGACATCAAAAAAGTGGCAGGAACGACTTGGATGAGAAAAACGCAGGATAGATTATTATGGAGAACCCTTGGGGAGGCCTATGCTGTACAGCAAGACGATCAAGAAACCGGTGTCGAATAA
Protein
MSEDMTKLFQMMKLELDKQTATITQSVTDSIMRNIDDKIKPILEENKYLKNEVQKLNDKARYLENKDTGNEIATRIEKPSNTYNENPNTAGHRGVTDHYPQDLENFDSNPNPTKNQTLNEANTKARKHRIYIATLNTRSLKSKEKLLELEQALNHINWDILGISDVRRSAEKIEEHDEYILYYKNEQPGIYGVGFLVKKYLKNNIIEFKGVSNRIAILNITLPGYKNPTSIVQIYAPTETAKKETKNEFYKSLNEIMENLYKTIIVMGDFNSQIGQRRKNEDKIIGPYTIGKRNDNGQRLINYAAENNLTVMNSFYKRNLLRKWTWQSPDGITRNEMDFITTNKPKLFLNVEVLNRFNFNTDHRLLRGHLHMFQPKNQRKFIKNRKLPIILPVPNYILKSLEIKLRPIKELKTTQEKYNTLENVLKEINKQLERENTPKDRLGPIARELIRKRSLLFSNRKNNKQEITKISKNINLEIRKHKQKLRTETLQLHIDKSGGLKKAWKELQEYTTWINNVTHHKTKKHKSERSDILQTATDFYRELYDDQSITPTLSKEEEKNSEEQVPSILIDEVNNATKSLKKNKAPGEDNISNELLVGMYHAISNTLTDLFNDILTTEHIPQQWTTSTIILIHKKGRTDDISNYRPISLMSNIYKLFSKIVLERLTRTLNENQPKEQAGFRSGFSTLDHIHTIKQIIQKCNEYNINYYLSFIDYNKAFDSLKHQKIWEALALQGVHNKYIRLLKNIYENMKARVRTEKLGEHFHIKKGVRQGDPLSPKLFSATLEHVFRQLEWDDYGININGVLLNHLRFADDLILISENPETLQKMIEQLVRESEKVGLSLNTNKTKLMTNYKKVPIKPYNTAKLEYVNEYTYLGQIISPKDLTAKEISNRINIGWKRYWALKDVMKNSEIPVKAKKKIFNTCILPSMTYGCQTWGLTNKNIKSLEICQHRMERSMLNMKLKDKIRLTKIRKQTKIIDIKYRIQQLKWKWAGHLIRDKTEKWAKGVTEWCPRYKKRNRGRQQRRWEDDIKKVAGTTWMRKTQDRLLWRTLGEAYAVQQDDQETGVE

Summary

EMBL
FJ265561    ADI61829.1    FJ265564    ADI61832.1    FJ265563    ADI61831.1    + More
ODYU01008249    SOQ51673.1    FJ265562    ADI61830.1    GBGD01000380    JAC88509.1    FJ265542    ADI61810.1    GBBI01004876    JAC13836.1    ODYU01004088    SOQ43598.1    KZ149907    PZC78256.1    FJ265551    ADI61819.1    FJ265550    ADI61818.1    FJ265549    ADI61817.1    FJ265545    ADI61813.1    FJ265543    ADI61811.1    FJ265544    ADI61812.1    JARK01001655    EYB84321.1    JARK01001565    EYB89683.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001337    EYC34625.1    GL379822    EGT48339.1    GBBI01004877    JAC13835.1    DS268444    EFP01729.1    JARK01000388    EYC37469.1    JARK01000173    EYC41342.1    JARK01001370    EYC16150.1    DS268591    EFO92565.1    GDKW01001596    JAI54999.1    AF054983    AAC72298.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01001475    EYB97550.1    JARK01001531    EYB92324.1    JARK01000063    EYC44387.1    JARK01001497    EYB95322.1    EYC33297.1    JARK01001421    EYC04912.1    JARK01001340    EYC30744.1    JARK01001612    EYB86585.1    JARK01000109    EYC42952.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001470    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001353    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01001389    EYC10874.1    JARK01001401    EYC08686.1    JARK01001344    EYC28216.1    JARK01001407    EYC07212.1    JARK01001582    EYB88498.1    JARK01001581    EYB88505.1    JARK01001372    EYC15614.1    JARK01001637    EYB85284.1    JARK01000204    EYB98081.1    EYC40601.1    JARK01000146    EYC42042.1    JARK01000008    EYC46079.1    EYC03125.1    JARK01001500    EYB95049.1    EYC30828.1    JARK01001346    EYC26445.1    EYB85282.1    JARK01000302    EYC38674.1    JARK01000165    EYC41537.1    JARK01001357    EYC20551.1    JARK01000161    EYC41641.1    JARK01000460    EYC36749.1    EYC22263.1    JARK01001618    EYB86258.1    JARK01001621    EYB86109.1    JARK01001354    EYC21986.1    JARK01001473    EYB97806.1    JARK01001626    EYB85833.1    JARK01001348    EYC25048.1    EYB85285.1    EYC25050.1    JARK01000132    EYC42415.1    JARK01000177    EYC41210.1    EYC41209.1    JARK01001524    EYB92970.1    JARK01001343    EYB95040.1    EYC28825.1    EYC25046.1    EYC16376.1    EYB98082.1    EYC40602.1    JARK01001502    EYB94855.1    EYC25049.1    JARK01001365    EYC18010.1    EYC18009.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF00069   Pkinase
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR029052   Metallo-depent_PP-like       
IPR000719   Prot_kinase_dom       
IPR017441   Protein_kinase_ATP_BS       
IPR008271   Ser/Thr_kinase_AS       
IPR011009   Kinase-like_dom_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF56112   SSF56112       
Gene 3D
PDB
6AR3     E-value=2.50841e-05,     Score=118

Ontologies

Topology

Length:
1067
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00132
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00005
outside
1  -  1067
 
 

Population Genetic Test Statistics

Pi
47.107001
Theta
22.218375
Tajima's D
2.374666
CLR
3.677742
CSRT
0.931603419829009
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号